Description :
From Genome Similarity Track
Location :
contig_9:82581- 84169
Transcript NameFunction/comments
g2216.t1hypothetical protein F441_16766

Sequence
1588 bases(100 bases per row)
CTCAGTCGCCGCAGGAGTATGACGGCGGTGCTCTTCGGGAGGGAGGGGAGGTGAACATTTGGAGTCGTGAATACATCGGATTGGTCGCGCAGTACGCCGC
GGTGGGTATGATCTTCGGAACTCTGCCCGGCACAGTCTACCCGTTCCTCTTCAACTACCTCAACATGGAAGGCACGCAAGTCGTGTCGGCTGTGGTTCTG
CTCAACATGCCGTGGTCGTTCAAGATTTTTTACGGCATGATCACGGACTGCGTCCCTATTTGGGGGTATCGACGCCGTCCGTTCATGGTCATCGGATGGA
CCCTTTGTTTCGCGATGCTGCTTGTCATGGCCTGCATGGATGCCGGCGCTCCATACTTTCCGGACAACAAGTACGCGACGATGGATGAATCGGAGCTGAC
CCCTGAACTCGTTGCGACTTTCAACGACTCGGCACACCACGTGGGCGGCAAGTTTATCGTGCTTATGATGATCGCCGCCATCGGCTACGTCGGAGCCGAT
GTCGCTGCTGATGCCATGATGGTGGAAGTAGCTCAACGTGAACCGGAGTCTACGCGCGGATACACACAAACCACGATCTACATGATCCGCACGGCGTTTG
TGACCGTTTCCAGTATCCTCACTGGTTTGGCTTTCAATGGCAAAGACTACGGGGGTGACTTTGACTTCTCGCTGAGTTTTCCTCAGCTTATGGTTATTCT
CACTATCTGTTGTCTTCCAGTGATCCCTCTCTCGTGGTACTGCATCAAAGAGGAGCGCCATCCTGGCGTGATTTTCCGTGATTACATGGCTGAACTCTGG
CACCTCATCCAAACGCGCCCGGTGTACCAAGTCATCGCGTACAAATACTTGTCGGGCATTTTCGAGAACTTCACCATCACTTGTGCTGACCCCATGCAGT
CGTACTGGGCTGGGGCCACCCCACTCAATCAAAAGGTGATGGCCATCATCGGCAACGGCATCTTCGCCCTCACGCTTTACTTAACTGGTAGATATGGTCT
CCACTGGAACTGGCGATCAATGCACGCCATCACGATCGTCTCAGTCACCATCATGGACTTCATTGTAACGATGCTCACGACGTGGGACGTCCTACGCAAC
CAGTGGTTTTGGCTCGGAGTGCCCGTGGTGGAGAACCTTCCGAATGGCATCTCTTTCGTGATCGGAACGTACGTGATCGTGGAGCTGGCCGGTGAGGGTA
ACGAAGGTGCTGTGTACGGACTGGTGGGATCGATCTCCAACATCGCTATTCCCCTGGCCAGCACGCTGTCGAAGAACGTGGACAGCTACTTTGACGTGAC
CAACGCCGATATTGTCGAGGATTCGACCCATGTGCGCTGGGATGTGACGTACGTCCTCATCATCCGGTACGCTATGAACCTCGCGGGACTTGTCTTCCTG
CCGCTCCTCCCGCGCCAGAAGGCTGAGACGCAGCAGCTCAAGCAAAACGGTGGCTTCAGTCGCTTCATGGGAATCCTGACCTCCATCTACTTCGCGTTTT
CACTCTGCTGGACGGTCATGGTGAACATCATGTCCATCTACCCATCCACTTCATGCCTAGTAATTGCTGGTGGCACCGGCTGTGACTC