Description :
From Genome Similarity Track
Location :
scaffold_140:8258- 13918
Transcript NameFunction/comments
g4451.t1 reverse transcriptase

Sequence
5660 bases(100 bases per row)
GCCGAAATTCTGGCTATTTCCACGGAGCACGCGAGCTCCCCCTGCGAACTCGTGGTTTTCGGACTTGATCACCGAGGCCAAGGTTCGTGCATTGTATGCG
GCTACGCCTCCGCCTTGGAACGCTATGCATCGTCTCGTAGTGCCCCGATCCTTTGAAGTGACTGGGTGGTTCGCCGACTTTTGCCGGCTTTACACGGACT
TCGATAAGGCCCATCTCCAAGTCTTTTGGGAAACCACCCACAAACTACCTCTCAGCGCCAGTCTACGTGCGGCGGTCCCATACCTGGAGGAGTACCAGAA
CGACTGCCGACTCCGTAGGATGCGTGCTGGTCCCCGGTGGCGGAGGTTGCTCAAAGGTCTCAAAAGCGGGGAGTGTGACCTCGACCTCCTGCTGGACTCG
TTCTTCTTGCACCTCCCGGTGCGTGGAAAGCAGGTCCACTGGTATGCAGGCCGAGGTGAGAGACAGCGTCCCGCCGACCGTCTTGCCGCTCTCCAGATCG
CCGACGCTGCAGAACCGTGGCGTAACCAGTATCGCGCGAACAACGTGGACCATCCTTGATCACGTCTTATGCGGCTCGACAGGAAGTTCTTCGTCGCAGC
CGATAGCGACTAGGTAGCGAGTTTAACCTTCTCAATACGTAGCTCTTCTCAGGTAGAGTTGGAAGGTCTCTTCCAGATGTCTCCTCTTGTACTCACTTTA
ACAAATAACCCATCGTCCCATTTGTGCGGCCTCCCCGCACAAATCTCTCCCCCTTTCGCACCTACTGCGAAGGGTCTCCACCCACTCCGTCTTCGTGGGA
TTGCATAACGCCGAAGTGGTTGCGGCTGACCTGGCTTCTTTCGAACTCGCGAAGCAACGCCCCACAGTTCAAGTCGACCTCGTCCACCCACGTCGGATCG
TCATACCCCTTCCAGTGCACCAAGAACTCGCGGCAGTTCCGCCCGTATCGCGTCTTCCGAGATGATCGTACGTCCGCAATTCGCTCCACTTTGTACTCGT
CTTCATCTAACTCTCGTTCCCAGCTGTCTTCTGGAAGGAGCGCTTCGTCGAAGTCCACGCGATCTTCATCGGGGCCGACGATCTCCAACTTCGGCCGGTC
AGGGAACTGCTTCACCAGCTTGAGCTTCGACACTTGCACGATCGGGAAGATCCAGTATTCCGTCCCGGCGATCTCCAGCTTCGCGGCATGTTGGTCGATC
ATCTCGGCAACACGGAATGGCCCATGCCAAAGGTGCGCAAGGTTCCGAGCGTAGTCAACTTTGACGCGATCCAGATACAGCCAGACCTGATCTCCGGCCT
CGATGTGGTGTGGGCGAAGATCTTCGTTGTGGTGATCGGCTCGTTCACGGATGGCTTCGCGCAGGCGTTCGTTCACCACTTCGCGGGCTCGCTGGTAGTG
GCTCTGAACATGGTTACGCCATCTCCGCGGATCGCGATCTCTGCGCCGCGTGCTTCCCACGGGCAGCGACGCCTCCAAGGTAGATCTCGGATCCCAACCA
TGCACAAGGAAGAACGGCGTATCTCCCCGAACTCGATCTTGAGCCGTGTTCAGCGCGAACGTCAGCCGCTCGGTATATTCGTCCCAGTCTTTCTGGTTGA
TGTCTGCGACATACATCTTGACTGATCGAGTCAGCGTCTGCACGATACGTTCTGCTGTTCCATTGGCCTGAGGACGGTAAGCCATCGTCGGGCTTTGTCG
TTGGCCCACAATGCGATTGAACGCACGAAAGCCATCTGCCATGAACCCGGGCTCGCGATCGTGCCGGATGACTTCGCTCGCTCCGAAACGACGGAAGACA
CTCTCTTCATAGCTCTCGGCGGTCTGTTGGGTGGTCCGGGCGCCGCTCGCTTTCGCCAGCACGTACCCGGTGAACAGATCCACCCAGATCAAGAGCTCCG
TGTTCCCCTTGTATGACTTCGGGAGCGAGGGGATGTGATCCATAGCAATGATCTGGAACGGGTAAGTGGCCTGCAGGTTCCCGGGCGATCTTCCCTGAAT
GGTAGGTCTTCCTTTCCCAGTCTCGCAGTCAACACACTCACCCACGTATCTCTGGACATCTCGGAACAGGCCCCTCCAGTGGAAGTGCTGCTTGATCCGC
GCGTAAGTTCTTACGATCCCCTGATGCCCGCCTTCCAGGCTCGCATGATAGTGGTGCAGGAAGTCTTGGCGCAGCAATTCCGGGATCACCAGCTTTGCGG
TCGTGTCGCGATCTTCGTCCGACTTGGACGTGGAGATCGGGCAATACAGTAGGAGTCCATCGTCATCAACCTGGTACGAGTCGGCGATCTTCGCACAAGT
CCAGGTGTCCTTCGCCGCCAGATCCGCCACGTCCCCTGTCAGGTACGTCTTCAGATCGGCGATCCACTTCTCTTCCCCTTGTGCTTTGACGATCCGTTCT
AACCTCATGCTTTGAACCACTGACTCCTGCAGGCATTCCGGGGGAGCACGCCTTCGTGTGGACGTTCGGGTCACGGCGGAGACACGGACCACACTCTCTT
CGTTCTTCGGCTTCAAAATCTCTCCAAGCCGATTGAGTGTGATCAAGTCTTCGAAGATCTCCGTCGACGTCACGACCGTCCCTTCTTCCGCCTGCAAGGC
TTCGCTGGCGAGACAATCGGCGCTCTGGTTCCATTCCCGCTTCACATGCACGAACTCGTGCTGAGGCCACGACGAGAGTTTGCCCATCGCTTTCTCGCGC
AGGAGCTGCAACGCGGGCGCCTTGCATGCGATCTCGCCACACATCTGCCGGATCACCAAGTTGAAATCCCCGCAGATCACCAGGCGTCCCCCGTCGAATG
ATGACAGGAGATCCAGGCACAGAAGCAATCCATGGTACTCGGATTCGTTGACGATCATCTCGGTTGCGTACCGAGACGCCGCCGTGAGGATCGTCCACTC
GGGCAACTTCCAGACGACAGCGCTGTATGCTCCGCCGCCACGTTTCACACGAGCAGACCCGTCGAAGCTCACGACGATCAGCTCTTCATCCAGTTCGAGA
GTTGGCGTGGGCGCAACGATCACTTGCCGGGGCTGCTTCCTGGTGGCGACTGCGACCAGAGCTTCGTCCACTTCTTCCCGAGAGGTAATGCTCGTGGCCA
GCGTCCCCAAGACCTCGTCTTCGCCTTTCGTGCATCGCACAATCTCCAGCGTCCATTGAGACAACAGTGCGGTCCATGAACCCAACCGACCTTGAAGGCC
TGACGATCGAAGCAGCCAAGCCAGTGTCGAGTATCGCGACAGCACCTTAATCGGTTTGGCGACCAGCATAGTGTGGCAGACGTCCAAGATTTGCAGCAAG
GCCAAGACTTCCTTCTCGACGATCCCGTAGTTGAGTTCGTTCGACATCAAGATGCGACTGGTGAAGGTCACTGGCCAGAACACGCCATCATGTTCTTGCA
TGAGAGCCGCGGAGATCGCCCACTTGTTCGCGTAGACCACGATCACTGGGGGGCGGTCGGGGTCGAAGTGCTTCAGGATCGGGGTTGACACGATCTTCGC
CTTCAGCATGGTGAACGCGACGGTGGTTATCGTCCAGCGGTCCTCGTTCTCCACTTGGTGGACGTCCCCAGTCTGCGACGGACGGTCCGTGATCTCGCTT
CGGCGGCAATGTTCGAAGAAGTCCGACTCACGCAGCTCGTACAGGATCGCGGCGTACACTGCGAAGTCCTCGATGAAGCGGCTGTAGTAATTCAGGCTGC
CGAGGAACGACTGCATCGCGCGCAGTGTCTGCGGGAACGGCAAGTTGCACAGCGACTCCAAGTCCTTGGGTCGCGCCTCAAGTCCTTCGATCGAGACTCG
GTGACCAAGATAGTCCACCTTGCGCATGCCCCAAGAACTCTTGACCACGCTGATGGACAAGTTCCAGCGATCGCAGGCGTCGAGCAGCTTGTCGACCTTC
CCGCAGAGATTGTCCCACGAGTCCGCAGTGACCAGGATGTCGTCAATGTAGAACCGCCGTCCCAGTACCGAAGGTTTGTGGTCCGTCTCCGGCTTGCCTG
CCTCGAACACGTCAACATGATGTTCGGAGTCTTCGCCATTGCCGATCCGGAGGAATCCATACAGGGCATTGTCCAGCAGCCACTGGTAGATCTGCGGCGC
GTTCTTCAAACCGAAAGGCACGCGAGTCCACTCGAACAATCCGAAGGGCGTAATGAACGCCGAGATCTTCTGAGCGCGCTCCGTCATCTGAACTACCCAG
AATCCACTCGCCATGTCCAAGGAGCAGTACCAGAGAACCTTGTCAAGATCTTCAAGGAGGTCATTAATCAGCGGCATGGGGTACACCATCAGTCTGGTGA
GGGAGTTCACCAAGCGGTAGTCGATGCAGAGCCGGATGTCCACCCCGTTCTTCTTGATGATGATCACGATTGGAGAAGCCCACCGAGAAGTCGACGGGAC
GATGATCTTCGCAGCCAGCAAACCCTTGATGAGGTCGGAGAGTTTCTCGTGATACTGCGGCGCTACCCGGCGAACACGTTGTGCGATCGGGGCTGCACCT
CCTACGTCGATGTCGCAAACCACTCCGACTGCTGCTGGCAGTAAGGCGTTCCCCTTCCCGATCAGAAGATGGTTCCTCCTCCAGATGATGCGCCTTAAAC
GGTTGATCTCCTCCGGCGTATTCCACTTGGGATTTCCAGCTTGGATGTCTTCGATCTTGACTTCCTCGGTCGTGTTCACGATCTCGGGCAAGACAGCCAT
CTGCCCCTCAAGATCTTCAGCAACGAGACTTCCACCATCGTGATAGTACCCTTCATCATCTTCCCGAAGCTTAGCGGGTTCTTCCGAGACGTCGCCCTTC
GGTTCTCCCTGGGGTTCTTCCGAGACGTCGCCCTTCGGTTCTCCCTGGGGTTCTTCCGTAGCGACGTCTTCAGCTGGAGTAGGCATCGGTTCTTCGGAGT
CCAAGGTGAGGCCAGCTTCCGGTTCAGGGGAGCCTTCTTCTTTCGCGCTCTCTGGACCATCCCGGTCCGCGCTCTCCTCTTCCGTGTCCAACTTGGCTTC
TGAGATGTCCGCGTTAGCCACAAGGGGTTCGGCCCAACGGACGGTAGCCGCTGCGACTGTTGGCCAAGGCGCCGTTTCACCTTTCATCAAGATCTTCGTT
GGAGGGTCGTATCGTGGGCGCTCCACCAGCGGATCGGAAGACTCAGAGAGCGGCTCCTCGTGCTCCTGCCGATCGGTAGTCGCCTCAAATGCGAGAGTTC
GCCACTCTGCATATCTGCGGGATCCCACCGACACGTGGCCTGGAACGCGGGGAACAAGATCTTCAGCAAGCCACATCCCCAGTTCAGTACTTCGCGGCAG
GTGAAGCTCTTGATCGCCGACGTTGGTGATCCGCAGGTGTCGCCTTCGTCCAAGCCCCTTCACGACGGTAGGTACCCATCCTTCTCCACGCACGATCCAC
AACTTCTCTCGATCTAACGCGCGTGGTGGCTTTAGGGGAACTTCGGCGGCTCCTGCTACGGGGATCAACACGTCATCTTCCAGCAGCAGCGAGTATCTGC
TTCGGCCATACGGCGGGCGTCGTCCTGACAGCTGAATCCTGACCTCGTCGGCCAAGCACACCGTGCCGTCCGCGAGATCGAGTCGGATCCCGGCAGGGAC
CATGAAGTCCATGCCCAAGATCGCGTCCTGACCCGCCAAAGCACCAACCCAAGCGTCGAA