Description :
From Genome Similarity Track
Location :
Scaffold_173:82569- 83608
Transcript NameFunction/comments
Hyaar_Emoy2811870syntaxin 7-like protein
Hyaar_Emoy2811871syntaxin 7-like protein

Sequence
1039 bases(100 bases per row)
ACTGACTGGATTGTTGACGCCACTCCAGCTCTTGCTCCTCCGACGCCGGTTGGCTCGGCTCTCTCTCGTCACCACTCTTCATTTCTCTCTCTCTCTCGCC
GCAATGGGCGATCGATACCACAGCTCGCAGTCACCGCGCAATAGTGATGGCAGCGTCTCGGACGAGCGCTTTAGCAAACTTGTCTCGGAGACCAGCAAGG
GCATTTCCAGCTTTAATCAGCTCACGCGCAGCATTGCGCAGAAAATGTCCTTGTTTGGGACACCGCAGGATTCGCGCGCGAACCACGCGCAGATCAAGGA
GTTGACAGAGAAGGGCAACAAGATCGTGGCCAAGATCAATCGCCGATTGCAGGAGCTCAGTCGAGGCGCCAAGGGCCCGAGCGGCCGCACACGTCGAACG
CAAGTGAACAAACTTTCGGCTGACTTTAAGAACCAGGCACGTGTGTTCGAAGAAACCTGTGAGCGACTGCTCGAGTCCGAGCGCCAGTCGGTGGAGTTCA
TCCGTCGCTCGTCGCAGAGTTTTCGAGGTGGAGACGGACGCAAGTCACGGGGCGATGGACCTAAGCCACGTGGCGAGGCCGAGTTTACAAACTACAGTGA
AGACCAGATCTACGCACAAGCTAATGTGGTCATTTACGACGAAGATGGTGCGCTCTTTTCGCTCTGTTTGTGTGTGCTGGAGTAAGTGGAGTTGACACGT
GGTGCTACTGGTTGTTTGTTTGGCTTGTGTAGATATGCAGCGGCGAGAGGACGACATTATCCAGATCAATCATCAGCTGCGTGAGGTGAATGCAGCTTTC
CAGGAGATTGACGGGCTCGTGCAGGACCAAGCGGAGATGGTGGTAGATATCGTGGAAAACACCGACACGGCCAAGGACAACGTAGAGAAGGCATTGGAGG
AGGTGCGGCAGGCAGAGCAGCGCAGAAATTGGTGTGCGTGCTCGCGGATCAAGCTGATTATCATTTGCATTTTCACGGTGCTCGTCTTCATCGCCCTGAT
GGGAATCATTTTTGCCGCCAAGGGATCGGATACGGCGGC