Description :
From Genome Similarity Track
Location :
Scaffold_5:825626- 836557
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04585transmembrane protein
Phypa_INRA-310PPTG_04586hypothetical protein
Phypa_INRA-310PPTG_04587hypothetical protein

Sequence
10931 bases(100 bases per row)
CGTAATTCTGCCATCGCTTGGATAAAGTGCACGTATCTTCGACATAAATCCCAGTCCTATTTACAGTGCGTACTCGACACCCACCGTAATACGCTCTAAA
CAGCGACTGTATGACGGTCTTGGCGCGGTAAACGGTTGGACTAGACGTGGCAACAACTCGAGAAACTCGTGGGATACTACTAGTAAAGCCGTACGGGAAC
AACTTGAGTAAATCTGGTACAACCAGCACTGGATCTTCCCCTCCAGTCGCTAACGCTAACTTTTCCCCTATTACATATTGATACGGGACTTCAGATCTAC
ATTCCGTATACTCCGGGAATACGTTAAAGTCCGCAGCAGGGATAGAGGAATAGCCTACGCTGTTCTTAACAGCTTGGAATTTAAACAGCCGAAGATGGCT
CTCGACTGCCCACTTGGTCACACATTCGTTTTTGAGTTCAATACCTTTCTTCGCTTCCAATAGCTGTTCTGGTGATACAGAAAGTTTTAAAGTTTCAATT
ATTTCAACAATTTCTTCCGCTTCCCCCGTGATAATTGACAATGGAGATCCCCATTCATCCACTCCACCGGAACAGGTGGCTCCACTCGCCTCGAGTCTTG
CGGCTAAAGCCAGTCCTTCGGCACCGATTAGACTGTAATCCCGGGACGTGGCTGTATACAGGTCTTCGAAAGTGGGTTTACTCATTAAAGCTTCGTGGTG
AAATGTGGCCATTTGATGTAAAACCTTTTTACACTCGATATGACACGGTGTGCAGCCTCCAGACATGACCAGGTCCATCTCACTAAAGGCAAAATAGCTG
TCTTTCGCTTCGATTAAAAACGTCCCAGTTGTGAGATAATCCGTGAAAATAAACACAAACAACACCATTAAAGGCGCCACGAAAATTCTTCCAAAAATCG
CGAGACAGGCACCAATTGAAGCAGGGCGAATCTGACGATACCATCGCTCGCTCCGTCTTCTTCTCTCTCGTTCTTGTTCGTAGTAAGCCACTGACCACGT
CGACTCCGTTCGCTGGGGTTGAATTGTATTGGTCTGTCGCCATGCTTTGACCTTAGCGAAAGACTCCCGTAGAAAAGAAAGCTTCAGTGCTGTAACCCAA
ATGGGTGGAGTATTCGGGAAGGAATGCCGTCGTATTTGTGGTTTTAGTGAAATCACGGAGAGAGACCTGCGTACAAATGCCTTCATTTGCGGTAAAACGT
CAGTATTTGGAGAGCTCTTGATCTCCGTCTTGAATGGAATCAGCTTGGAGCTTCGCCTGGGTGACCGTCGTAATAAGGATGATATGTGTTTTTCTGCATC
AAGTAAAGAAGAGGAAAATGGGACTGCTCGAGCGGAGCCTTCGGCAGACCTCTGGAAAAAAGAAGAGCGTACAAATGAGCGCGAGTCGCCTGATGTTCTA
GTTGCAGATTGCGTCCAGGCCATTTATCTCCACGAAGACCACAATAAAGACTTCAGAGGATATCTGGCACCCGTTGAAGGCAAAAATAGGAACGTAACAG
CACCAAAAAAAAATACGCCACAAGTATTCACTTACAGATTTGTTTTCAAACGAGCGTATCATTTCCTATTAACAGTGAGATTTTACAAAAATTCATGTGT
TTATTGAGAAACTAGGCTATTGGGGTTGCTTCAGATATCTTGTAGTTCTCTGCACTAGCAGCGAACCACGTGCAGGATAAGGCATGAGTCAGCGTCCCGT
TTTCTGGATCCATATACCATCGGATGAGAAGCACATTAAAAGTGCGAAGTAATTTACGAGGAATGAGTCGAGCTAGAAGCAATAACACCACTGATCCAGC
CTGGTACACGTGTTGGCCGTAGAACAAATATCCTGTCAGCAATATAGCCTCCACACTCGTGCATCGCTTGCCCATATACTGAATACAAGCGAAATCGTCG
CAGTCTTTGAATAACCTCGTAAATGGTGATCCAAGACAGTGTTCCTCGAACGTCGTGAGTGGTGGAAATTCGATTAGTTCTTTCGATTCTTCCTTTTTAA
CCTCCACCAGGTTGGTCGATTTGCTGTTATGAACCATGTATCGATTGGCTCCTTTAGCAACAATCGTCACTTTCTTGGATGATTTCGGTGAGGATGGAGC
GTTCGATCCATAGCGCTTCTGGACGAAATAAGAAGCCGACAAAGCCACGAGTCCCAATGCTGTCGAGATAACAGCAACTAAAACAGCCAAGTTAACATTC
ATGAGGAAGCACGAGTCGTGGAGACCGCAGTATTTCTTGCCCAAAGTCGTCGTCTTCCGCAGTAATTGCCCGTTATAGTCTACGATCCAACTCAACGATT
TGGACCGGATAGAGTACAGCAGCACTGCCACTGCAGTCGTGATAATGATTTGCATAGTTTCCCAGGTTAATCGGAAGTACCGATCCAGCTGCTGTTCTCC
TGATCGAGCCTTGGCCAGATTGATGAATGAATAAGAGAAAATGAAGAAACTAAACGTGAGATTGGCTACAGACTCGATCGTTAACGTGCCTGTAACCAGC
CCCACATAGTACAAATCCGAGTTGTAGATTAAATGGTACGTGATCTGCGCGAGGTAAAGCACTTGCATGCGTCCGTTCTGGCATCGATAGGCCCAGATCT
GCGTCAAAAGTACCGACTGTTTGTGCGACATAATTTGGTACAAACTGATGATCCCCATTAACATCATCTGTACCATGACCATGCCGGGTAATACACTAAG
TGCCACCGTATCTGCGTATCGATTACGGAACACGCTAATCTTCATCAATGCACGTCCTGGTGTCTCGTCCGTGCCCGTAACCCATTCCCAGAGTGAGTTA
TAGTAGTTGTGGATACAGATACTGTCACTACCGGTTGTACACGCTGGGATATCGTCCGGGGCTTGGAGCATAAGTCCATAATTCGCCCAATGTTTGACAA
CGTTACAGGTATCTTCGATGTAAACTCCCGTCGTGTTGACTGCGCGTACTCGACACCCTCCATAGTACCCTCGAAATAGTGACTGGTTCACGTGTTTTAC
GTTATAAATCGTAGGACTCGTAGTGGCCAATGTCCGCGGAATTACAGGTAAACTGCTCTTAAAACTGAAGGGAAACAGCTTGAGAATATCCGGAACCACA
GCAACCAAATCTTCTCCTGCAGTCGACAAAGCCAACTTCTCTCCAATAACTCCTTCATTATTTACTGCAGGACGACAGTCCGCATATTCCGGATAAGCGT
TAAAGTCTGCCGCTGGGATGGAGGAATAGTCGATGCTGTTCTTAACTGCCTGGAACATAAAGAGTCTCAAATGGCCTTCAACGGCCCATTTTGTGATACA
TTCGTCCTTGGTCTCAATGCCTTTCCTAGCTTCGGCAAGTTCCAGTGGAGTCACGGACAGATTCAACGTCTCGATGATCTCGACTACTTCTGCTGCCGTG
CCAGTGATAATTGAGAGCGGGGACCCCCATTCATCGACGCCACCGGAACAGATAGCGCCACTAGCTTCTAGACGATCAGCAAGAGCCAGCGCTTCGGAGC
TGAGTATACTGTAGTCCCAGGATGTAGTGGTGTACAGATCCTCGAATGTAGGTTTACTCATAAGCGCTTCGTGATCGAAAGTCGCCATTTGATGCAGCAC
TCGCTTGCAGTAAGTATGACACGGTGTGCATCCTCCAGACATGACGAGATCCATTTGACTGTAGGCGAAGTAGCTGTCCTTGTACTCGATGAGGAACGTG
CCGTCCGAGAGGTACCCGGTTACGCCAAAGACCGTCAGAAGCATCGCTGGCATGAGCACAATGCGTCCGAACACGGCGACAGCAGCACCGATAGCTGCCG
GTCGCATTTTACTCGTTAGTTTCTGCTTTCCTTTCAACGCCTTCTGCTGCTCGAAGTAGTGAGCTGACCATGTGGACATGGACCGATCGGGTATAGACTT
CTGACATTCCTGTGGAGACATACTGGTAATCTACGCTGCCACGTGCGGAGTCCAACCGAAGTTGAAATGGACAGCAAAGGCTCGAGGTTCCTCGATTATT
TTCAGGCTATTATGTAGCATCCCATAGTGCTGTTAGGTTTCTTCCCAGAAATGACGTAAGAAAACCTGTGTACGCAGTTTTTTTGCAGCATAACGTCTAC
TATAATCAGAGTGCTGTCTTGTTCCGCTAACTAAAAATATATGTTAGCTCCCATCCAAAGTAAAGTGTAAAGCTACGAGTTGATGGACAACGTAAGTGTA
TATTCAGTCATGACTATACTCAATGAAGACACATTTACGTAGCAGTGATTGTGGTGGCTGTGGCGAGTGCAGGACTTTCTCCTAGAGTGCTGCTACTCGC
AACAACCCGAACTGCGTATTCTCGTCCCGGAATCAAGTCTCGGATCGTATGGGCACGTAGTTCGAAGCGCGAGATTCGCCAGGCCTTGGCTTCGTAAGTC
ACCGGGAGCTCACATGCACTGCGGCCAGGATCGTTGGGATCTACAGTGATAACGTTGCCACTTTTGCTCAGCACCTTCATCACGCAGCGTAGTGTTGTGC
TTGAAGTACTTGAAGTGGGGCTGTCGGCGACGATGAAGTAGTCACCAGTGGACAAGGCCACGGAGGTCGTCACAGTCAACTTGCCGTTTCCTGAGTCGTC
TATTGTGAGTTTCTGCGCGCAGGACTCGCACAATACCGGTCGAGCGAGATCTGCGCTCTCAAACACGCCACTCTTCGCTGCGAGGCTCAGGATCTCTGGC
TTGAACGCGTTCGCGGTCGCCGTTGCGGCGTCAACGGTCTGGCGGGCGATGGGACCTGCCAGAGCAGCCGAACACTCGTTGTTAAAGACGTTGTTGGCAT
CAAAGCCAATGCGTCCCTGCCCACGCTTGGCATCGAGTCCCGGGCCGTATGTTGTACGTTGCGCAACAACCGAGTCGGGCGGCGAGGCCGTACAGGTTGC
ATCGGCGGCGTCCCAGTACAACAGCGGGATGTCGACCGGAGACGTGGCCATGGCGGTATTCTCTGCGGCGTCATAGCCCACAGAAGGAACCGCGACGGAC
TGGGGGAACGTGACCGTGTATGTGCGACCGTAGTCGTACGTCGCCGAGTCATCTCCCTGCATCACCGCCGTGCCGCCAGCATATACGCCTCCAAGCGCCC
GCATCGGTGTCTGCAGTGACGTCACCAGGTTCGCCGGGTCCACGCATCCGACCTTAGTGCCTCCGTTCGCTGTTTGCACTGTGAATTTCTTGTTGGCGAC
GTTGGCCACTGCGTTCGTTACCACGAGCGTCTGTGTCTCGATGTTCTCTCCACATTGACTTGAAAACCCAGCACCGTGATCCCATTCCACGCGATATTGA
TCCGTGTTGCTGTCGTCACTCCGCGGAGCGGTCCACACCGCGAGCATTCCGTGTGAATAATCAATCATCTTTGCCTTCACGCGCAGAGATCGCGGGGCGG
TCGGAGGACGCGCCACCAGTAGCAAATCGGCGGCGTCCGTCGCCTCCTGGAACGGCCCAAAGCCCACGCTGTTGTACGCTGCGACGCGTGCGTGGTACGT
CCCGGCAGCAAGCCCGTCGATCACGTACGCGAACGGTAGTCTTCCGACATGCAGCTGGGCTCGACCCTTGCGTTGCTCCTTGATCGTGACGCCAACTCCA
TTCTTGGTCGTAGCAACAATCGGTGGCATGTCGCCTTGTGCCGTGGTGAACTCGATCGTAAGGCCTTTAGCCGTTGCACTCGCAGAGCACACCGTCGTCT
GCGCTGTGTTTCGGAAGCGGACGTTCACGATTCCAACGACACCCAGGGCAGTGATTGCCGTAGCCAGCGCCTGCGCGTTTGCCGTTCCCAGGATCAAGCC
TGTCTCGAATTCGAGTATCGTTAACTTGAAGCTCATCGTAGCATCCACAGCGACATTACCCGTGGAGATGCACACCAGGTGCTGCAGTTCAGGCGTAGCA
TCTACAGCCGCGCGTGGGGCTACAATCGTTGGAAGATGCGGCACACAGCTGATCTGCTCGGCCGTCGTGCACGCCAACAGGTTCGTCCCAGACACTTCCA
GCTTATAGCCGAACGGGGACTGCGTAGCGAGCGCTGACCTCCATCTCTTGTGCTGGTTTCCGCCGTATTTGCGCTGCAAAAAAGTCACGAGCCACGTGTA
TCCGCCGGCCGTCAGCTCGCGGTTCACCAAGACGTTTTCAATCGTAGACAGCGCTACAAGCGCCTTCTGCATGTCCACAGCCGAGATATCATACGAGAGT
TCGGGGCTCCATTGACCGTCAAACCCCACGCGGAATGTACCAGACAGATGCGTATTTGTGCCTGCAGTTGGGGCCGAGACTGTAATCGTAGCAACGTCGT
CCGTCACACTCTGAGACGCCGCCTCAAGTGCGTGAACCACCGCAAACGGCTTAGCAGCAGTGGCGAGAGCACCATCTAGCCACCATTCCACACGGAACTC
GGTCACGGGCTCTCCGCCGTCGTGTACTGGCGCATCCCACTGAACGAGAACTTGAGATCCAGACAAGACGTCAGCGCGTGCGAGGCGGACGACATCGGGT
ACTTGATCTGCGAGTTGAATCGATACAGGTGTAGGTACAGCTGTGTCGCCCCACCCGTCTGCGTTGTGAGCACGCACGCGCGTGTAGATAGACACTCCAC
CGCCGCTAACCAATGATTTCATGTCCACTTCAAGACGCTGGAACGGGGTCACGCTGATCGCCGGAGACTGCACAGCCTGTAACGCGAGGCCGTTCGCTAC
CAGCGCCGGGAACACGCGCGACTCCATGTCCATCGCAGGAGACGGGAACTCAACGAACGTGACGCGCCAGTCGTAGCCGTGCTTGTTCACTTGGCGATCC
ACATCCGCGTTGGTTACGATACTCAGCGTCTCTAGCGCAGCCTTAACGTCTTCATCACTAGCGTCAAAGGGAATTGAGGGGGTAGTTGGTGCCTGATAAA
CAGTAACGAAGCTGTTCTGGTCACGCTGTACTGCCGGTACGCCGGCCGTGCCGCCGACATATGCGCTGCAGCCGTTGATCCCCACGTCCAGAATCCGTAG
CGTCGGCACCTTGCCACGCACTTGCACACCCATGAACTCCACCGTGTACTCCACCGTCACGCGGACGCCAGACGTCTCTGTGAGAGCACGTTTTACACGG
ACGTCATCAATTCCGGCAAAGTTCTCGAGCTCGTGTTCCAGAGTCAACATATCTCGAGACGCATCACTCGCAAGCGGACCCGAAGCCCACACCAGACACC
CCACGTCATCGTTTAGTGAAGCGCCACCGTCGCCCCCTGTGCCTAGTGTTAAAGAGCTCACTTCGTCGCCGAATTGGACACGGAACCCGCCGGTGTTGTA
GGTCACAGCAGCGCCAGTGACTGTCAACACGATCCGTTGAATCTCTCGAGTAGCGCCGCCGTGAAGCAGGTCAAGTCTTGGTGCTAGACTCACGGCAACG
GTCGGATCTATCAGACTTCCTAGCTTTAACCGTGTGACAGCTGAACGAGCGCAGTCGCATCCATTGGTATCACACTTGCTGCGTACACGGAATGTCGCTA
GCGCTTCGAGATCCTCAGCTTCGAGTCCATCATTTGGCGCTCTGCCTAGACGAATGTAGTCCCCGCAATTAATCTTCATCTCGTCCACTAATGTCACCTC
AGCGCTGCTTCCGATCGTGCCCAATTCAGTCGCTGTACTCACAGCCGAGTCGCTCCGAAAAACAGGTAAAGGCTCACGTCCTCCTGATGCGTCAAGGTTG
GACACTAGCAATGCGATACTCGAAGCGTCGAGTGCTTTCCACGGATCGTCACCCTCGCATAACGGTAGCAACGCCGGCCCGCGATGCACGAAGATGTTTG
GGTTTCCAGTACCCAATTTTGTAGCTGCTTCGGCGCAATTGTGGTCAAGTTTTAACGTCATAGTGGTAGCTGCCGTCACTCTGGCACGACACGTCGCAGC
AGCTTCGGGTGTTGATCCGATAGATATTCGAGTGTCCACCACTACAATATCCACAAGACGGTTGTCCAGTGCCGTGGACAGCGTTATCGTGTCCGTATTG
GCATCGTACGACGCACTGGTGATTGGCGCGACGCCTTTCACCACGAAGATTGACAGTCCGTTTGCTAGTTTCGAGACAGGGTTGGCACAGGAATGCTTGA
TATCCACGTGCAGTTTGTCAGCATTCACCGCCGTCACGACGGCCTGGCAGGCTGCGGGATCTGCTGGACCGTTTGCAGCCGCACCAACGGCAATCTGAGT
GCCTACAACGATCACCGCCTGAAGTGCTGTACTCAGTGCCGCCGATAGCGTGATGGTTGCTCCGCTGTACCCGGCGATAGTGAGACCCGTGTCGGTGGTT
CGTAGCTGCCACGCCACGCTGCCGTCGAGACAGACGCTGGCTTCTTCGTTGCGAATACGTACGCGTTCTCCTCGCGAGAAGGAGTTGTGCAAGGAAGCAG
CGCCGTAACCTTGGGTGATGTCCGGTTTGAGTCGCAGAAGGAAGGCAGAACCAGCTGTAAGCGCCTGTGCAGAAGCTAACGCGTCCACTTGTTTGGTCAT
CCTGCCGTGGAAAGACCGTGCGTCCACGGCTGCTAAAGAAAATGTACTGCCGGCGAGGAACGGGCCAGTGTGGGCGGTTGTAGTCACACGTGCGTACTTG
GTCGTTGGAGGTACATCCAGCACAACACTTGGATCCGCGAACTTGGAGTTCAAAGCCGCTCCGACGCGATAGCCGTCCACGTCACGTCCTCCTGACGTCT
GCACCTGGTCGAATGAGAACTCCAAAAGTTGAGGTGATAGAGGACGAACCGCCACGTTTTCCAGCGCGAGCGGGGATCTCGTGGGCGCTACACCGGTAGC
TGAAGCCAGAGTAAAGACGCCAACTCCGCGTTCATTTGCTGCCGCCACTCGCACAAAGTAGATCGCCCCCGTAACGAGTTGAGGGATGCTGTACATGACG
AGACCATCATCCGATGCAGCAGTTGCACTTACGACGGCCGAACCGAAAGCCTGTGGGGCCTGTCCAGCAGCGATGCTTGTCACTGCGACATTTGCATCGG
CTCCAACTCCGTTCGGGGTTAAAAGCCGATCGTTTGCTGTGAGTAGAGGGAACGCCGGGTTCGTCCGCGGCACCTGCGACGTGAACGTCACAGTCCACTC
GTACTTGTTTGCACCAACTGACAGGCGCTCAACGCGCACCAAGCCGACGCTTGGCAACAGCTCCAAAGCCTCCTGCATATCTGAAGGAGTCACATCCATC
GGCAATGGCGTCGTGCGCCATTGTGTGTACAATTTCGCGCCGAACACCGTGTCTCCAGCGTACGTAGTTGCTGACGCGCCCAGGTCCTTGGCTAGCGTTC
CAACAGCTTGGTATCCCGTCGCATCGGCTAGAGGGAGTTGCGAAGCTGTGAACGAACCTGTCGCCGATATCAAGTACGCCTGCTTGTTGATAAACACCAC
GTCTCCCACGGCTAACAATCCGGTCAGGTCTTCACTTGTCTTCAAGAACGAAGCGCCATGTTCCACGTCCACGGTTCCCGGTAGCATACGCCACGGATAC
AGGTCACTGCCGTCTCCGAATGACAGCATAAAGTAACCTCCAGTGATCGTACCAATCGACTTGACCAGCTGAACCACGGGAGCACCGAACAACGGCTCCG
TCACGGCTTGTTGGTACCATTCTACCTGGTACAGCTGGACATCCGCTGAAGCTTCAGGCCACGACACCATCAACGCTGTTCCAGGAGACTGAGCCGACAG
ATCATTTACAACAGTTACTAAGCTTAGAGCACCCGGTTTTCCTCGAGGCATCTCTCGCGCTGGTTGCGTCAGCACGGGTACGCCCGCCCCAACCTTGCCG
TTCTCAGCGAATATGCGGACATACGTCCACTGTCGCGTTGGCAGTCCTTCGAGAGTATACCGAAAGGCTCCGTCTGCAGCAGCTACCAACGTACTAGCTG
CTACCGTCACTTGGGCAAGTGCGTCGCCGTTTGATCCGCTGTCAAACTCCGGAGACGGATCCCATTCAATCATGTAGCCTGTGACGGGTGCTCCTCCAGT
GAACTTGGGAGCGGCGTAACTGATCATCAGAGACGTAGGCCCAGCAAGCGTAAGAATCGGCGGCGCTAGCATGTTGAACGGGGATCTGGGAGCAGACGGC
GGCTCGAACGGCACACTCAGCGACCGAGGAGCTGTAACCCGTCGCGGTCCGTAACCCAGTGCGTTATACGCCCCCACACGGGCGTAGTACCTGTTGCCAG
GGGTAAGTCCCTTGATAATGTACTCGTACGGAACCGGTGTGGTTTTAGCGTCCACGACGACCACGCCACAGTTGGTTCGTCCACTCACCGGTACGTTGTT
GACTGTTGAAGGGCAATACGTGGCTCCGTTCAGGCTTCCAACTTGGGTACCGCCAGTCACCGTAAGCGTAGCTTTTCCGCCTGCAGCGGATAGCCGACTC
GTGTACGTCAAAGCTGGCACGACGTCCAACTCGCTCAGGAACGTGATCGTCCAGGTACACTGGTTCTTGGTCGAACAGCTGTCGCGCGTCACAGTCACGT
CGCCGACATTGGGCAGATTCTCCAGTTCTCGTGCCATATCATCATCGGACGCGGACGCGCTCAGTGCTGACGTGCTGAAGATGCCTTGGATCTGGCAGTA
CGTACAGGTTGTCGTGTCCAATGTAAGCACGAACGAGCCGGCTACACTGCCACTGGAATCTGATGCTGTGCTAATCGTTTGGACTTGAGAAATGGTGTTC
GCGAACTCCGTGTCGATCCATTCAACAAGATACTTGGTTACGGGCGAGCCACCATTACCGTTGAGATCCGCTTGTGAGATCGTGGGCGGTGGGAACGACA
CGCGCAGCGAACTCACGCGCACGTCCGGATCATCTTCATCGTCGGGCGTTAGCGCAGATAGAATAACGTACGGAGACGGCGGTGGGTCACTCGAAGTGAT
CGGAGCAACCGCAATACTATCACATGGAGCG