Description :
From Genome Similarity Track
Location :
contig_43:82547- 83550
Transcript NameFunction/comments
g7455.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GTTGTAGTAGTGCGTGGCCTCGAAGTTCCACCAAATTCCAGCCAACACGAACGCTTGGACAGGACACACGTCGGTCAGGTTTGCTGTTTCCTTTTGTAGA
TCGGACGGCACGACGAGAATCTCGGACATTTTGTGCGGTATGACGAACTGGAGATAACTTCGTATTTGGAGAGAAAGAGGCACCACGCCCATGCAAAACC
ATAGTGCAAGCAGCATGACCTGAGCTGTCAAGCAGCGGCTTCTGGTTGATGAAGGTACCCGATAGGCAGGGTGCTCCTGGATGCTCCTCTTCATTGTCAA
TATATCTGCAGCTGCTCGAACTAGTGAGATGAAAGGAATCCGAGTGTCTGCTCGCGTCCGCTCAAGAAAAACCGCTTGGAAACGGACGAGATTTTCTCAC
GGAAGGCAGAATGATCCAACCCCTCTCTGGTTGTTGCTTACTTCGGCGTCGGGCACTGTCCAAGATGAACGCATATTGTGAGCGGTAAGGTAGCCGCAAG
CATGAAGCCTGGCAGGCATGAAGCCTAGTGGAAAGGCACTGCCACTTTTCTTCCTCTCAAAATATCCAAAAGTCAAATTGCCGATCGTAGACCTTAAGTG
CTTTTTTCCAGTCGATCATCATACCTTTCACTCAACTACAGTTTGAACCGATCTCTGGAGATGCCAATTGCTTGGTTTTGCTGCTTTCATCTCGCATTAC
CCGCTGTTCGATCACGTTCTGGACGTGCTCTTAAATCTCTGATATCATCGGACAAAATCTACTAGCAGACTTGTCGAGACTCCTCTTTTTCAGGACAAGA
ACTTCACTAGGTCGTGGGCGAATGGCATTATTCGGACTTGGCAAGTCCAGAGCTTTCGTCCGACGCCTGTTTTGAGCGTTTTGTATGAAGCACCGCCTAG
ACTTCGATCCAGGAAGCTGGTTATACCCGTGCATGTCGCTCGGTGCAGGGCCCCACACGTGAGTCCGTGATCACTCCTATTCCGAGCAAGGTATTCGCTG
GCG