Description :
From Genome Similarity Track
Location :
contig_43:82545- 83548
Transcript NameFunction/comments
g7813.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GTTCCACCAAATTCCAGCCAACACGAACGCTTGGACAGGACACACGTCGGTCAGGTTTGCTGTTTCCTTTTGTAGATCGGACGGCACGACGAGAATCTCG
GACATTTTGTGCGGTATGACGAACTGGAGATAACTTCGTATTTGGAGAGAAAGAGGCACCACGCCCATGCAAAACCACAGTGCAAGCAGCATGACCTGAG
CTGTCAAGCAGCGGCTTCTGGTTGATGAAGGTACCCGATAGGCAGGGTGCTCCTGGATGCTCCTCTTCATTGTCAATATATCTGCAGCTGCTCGAACTAG
TGAGATGAAAGGAATCCGAGTGTCTGCTCGCGTCCGCTCAAGAAAAACCGCTTGGAAACGGACGAGATTTTCTCACGGAAGGCAGAATGATCCAACCCCT
CTCTGGTTGTTGCTTACTTCGGCGTCGGGCACTGTCCAAGATGAACGCATATTGTGAGCGGTAAGGTAGCCGCAAGCATGAAGCCTGGCAGGCATGAAGC
CTAGTGGAAAGGCACTGCCACTTTTCTTCCTCTCAAAATATCCAAAAGTCAAATTGCCGATCGTAGACCTTAAGTGCTTTTTTCCAGTCGATCATCATAC
CTTTCACTCAACTACAGTTTGAACCGATCTCTGGAGATGCCAATTGCTTGGTTTTGCTGCTTTCATCTCGCATTACCCGCTGTTCGATCACGTTCTGGAC
GTGCTCTTAAATCTCTGATATCATCGGACAAAATCTACTAGCAGACTTGTCGAGACTCCTCTTTTTCAGGACAAGAACTTCACTAGGTCGTGGGCGAATG
GCATTATTCGGACTTGGCAAGTCCAGAGCTTTCGTCCGACGCCTGTTTTGAGCGTTTTGTATGAAGCACCGCCTAGACTTCGATCCAGGAAGCTGGTTAT
ACCCGTGCATGTCGCTCGGTGCAGGGCCCCACACGTGAGTCCGTGATCACTCCTATTCCGAGCAAGGTATTCGCTGGCGCAGCAAACCTACACAACTTGT
GCA