Description :
From Genome Similarity Track
Location :
Scaffold_1073:8253- 11392
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1073-snap-gene-0.5Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family

Sequence
3139 bases(100 bases per row)
TCGGAAGCGTCCGGAGGCCGTGGATGATAGTGCCAAACGCGTGCACGATGCGTCGGTAGGTCGTCACGAGGTCATCCTGCGGGTCCTTGGCGCGCGGTAT
CTCCTTGGCGAAGAGGCACACGGCGCCCACAGTCGTGACCATCGTAACCGAGAGCATACCCAGGAACCAGCGCAGCGTGAGGTGGGCCGCGCCAAAGCAG
TAGATGTACCCGGCGATCATGATGGAGCCGAGCGTCGAGCTCGCCTGACCAATGCCCGCGCCGAGTGTCTGTCGGTCGCCGGCAAAGTCGGCGATGATCA
AGATCGCGGGCGTCTGCACGACGTTGACCGTGACGTCCATCCACGTGTAGAAGAAGATCGTGAGCAGCGACGTCCAGAGGCGGCTCTCGTCGTCCTTGTC
GCCCAGTAACTCGCCGAGCTTGCGCGTGTAGCCCATCATGGTCCAGCAGATTGCGCTCGTGATCGCGCCGTAGAGCAGGTATGGACGACGGCGGCCCCAG
CGGTTCGTGCTGCGGTCGCTCAGCACGCCGATCGTCGGCGCTACGAGGATGCCCGAGAGCGGACCGATGACCTGCGTGAGCTGCACGGCGTACGGTGGCA
GCATCGTGCCCAGGTACGGCCCCAAGGCGGCCCATTGCGCCGCCCAGGCCATGTTGGTGGCCATCCGCGGCAGCGAGAGCAGCACGAGCATGGCGACCGA
GCAGCCGCGACGCGACGCACCGCCGTCAACGGTGTCTTGGAGAAGGAGGCCGTCCTGGACGAGCACGACCGAGTCGCTCTTGGCCGGAGGCGAGTCCACG
CGGTCGTACAAGGGCGTGCCTTGGTGCTCACGCTCGTGGGTCATAGCGAAAAATTGGTCGGGTGGAAATGCTGGAGTCGGGACTTGGACGCGTGTTGGAG
AGTGAGCTGCGAGTGACAGTTGGAGACCGAACGCCATCAGCAGCACTGGCCAGCCACTCGCCTCGTCGGCGTTTTAGGCGACTCATGTGCTATCGTCGTA
CAGGAAGGAGGTCAGTTGATTTTGTTGGTTTTGAAGCAACGGAGCAAGACCTGAGAACAAAGTCGACCGTTCCTCGCATCGTCCAGCGCGCTGACATCCG
AGACATGGCCACGCGTCCAAGTGCGAAGTCGATGGACGCCTATATGCTCGGCACAAGCTGGTGGAGCTCTCACGCCATGCTGTTGTTACATTGTCTCCCC
TAAAAAATCGGCGACGTCGTTGTAGCCTCGCGGCTTTGTCGTACCCGTCTCGCTGTCGCTGCTAACTGGTTGTCCTATGCTCTGCTTTGATTGTCTCCTT
CCCCCACACGTGTGGCTAGGAGGACAAGCTGTTCGGCGCCTTGCTCGCCGTGCGCTCTCGCTCCTGCATGGCGAGTCGCATGCGCTCCTTCGTGCGGTCC
TTGAGCGCCAGAAAGAACGCAATGTCGTCCTCGAGCTCGCTCAGCAGCTCGTGGTTGAGGCCGTCGGACTGTGCGTCGCGGTAGGTCGTGCGCAGCTCTG
CGAGGATCTGCAGCACCTCCTTCAGGTGGAGTGTGTCGCGATCGCGCTGGTCCATGAGCGTGAGGTTCTCTGCCAGCAGCACCCGGTTCTTGCCGAGGCG
GATAGACTCCATGAGCTGGTCACTCACGACCGTCCGGCACGAGCCGCAGAGCTGGGCGTCGCCCACCGTCGCCGTGTTCTGAGTGTATGTGTTGGCGATG
CCGCTGAGGATCTCGAGGTCCGTCGTCGTCGTTGTCGCCGTCGAGGTCGCTAAGGCCATCGTCAAGCCGTTCGGGGGCTTGCACATTGGCGTGTACTGCA
TGGACAGCACGGGCTGCGCGCTCTCGTAGAAGCCAAAGTCCGCTGCTGTGTTGCCAGCCATGGACCCGAGTGCTAGGTTATTGCCACCACCGGTGGGCGT
GCTGTGACCCTGCGGCTGTAGGAGATGCTGCTGGGCGCCACTGGTCGACAGCTTCCGCTTCTTCGCGAGACTCGGCAAGTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGCCTTCGCCGTCCTCCTCCTCCT
CGCCCTGTCGCTTCGCAAAGTCGTGGTCGCGAATAGCTACCAGATTGCTATTGCCATTGGCAGCGCCGTGGCCATTACTGCTGAGATTAAGGTTCCCGGC
CGTGCCGTCAAACTTGCGCAGCAGCAGGATGTAGCCGTTCTTGTTGTCGTTCGCGAGGGGCCCTTTCTTGATGGGCCGGATGCCGCGTCGGTAGCACTCG
GCGCGCAACACGTGGGCGCGCAGGCTTTCGTAGGGCTCGAGCACCTGGCGCAGCTTCTCGTCCGGTACTGCTGTTGCTGCTGTCGACGGCGCCGGTGGCT
CGCCCGAGAGCAGCGAGTCGAGGTCTCCGCCGCCGCTGCCGCCGTGCATTTCGATTGCGAACGCGCTTCTCGCCGCATGCTGTGCGTGCTGCGCCTGCGC
TTGCGCCTGCACCTGCGCCAGCGACTGCGACTGCATCTGCGCCTGCGTGTGGGCGTGCGCCAGCGCCGCGCTCACGTCCATGCTCGTGCTCCTGCTTCTT
TATCAGCGACTGCATTTGCGCCACCTTAATTGATACATGATTATGTCTCATTCAGTAAAAAGACATTGTTTCACTGTCACAAAAGGGCATCATGGAATCG
TGACATACGGTACAGTACATAAATGTGCCAAGTTTCAAATTCCCCATAAAAGATTTGAACACGGTCTAGATCAGCTCCAATTGTCTGCTAAGCTCCATTT
GTTTGACAAATTCGACAGGTTTCACTTTAGCTTTTAGAACAAGTCATTCGTTCCAGCCAATTAGCCTTATAGTGCGCGTCAAATAGATAAGGACCCCACT
TTTTTTTCGAAAGTGGTGGATTGTTTTTGTTTTACGTTTGCGGAGCTGAAAATTGTACACGAACGAGATCATAAACGGAACGTTCTCGTGGTGAAATTTC
AGCTTAGTAAGGATCTCCTGCACTGCCGATGGCAGCTCA