Description :
From Genome Similarity Track
Location :
Scaffold_32:82500- 86568
Transcript NameFunction/comments
Physo_134457reverse transcriptase

Sequence
4068 bases(100 bases per row)
GTTAGAGGTTCGAAATACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGGCGGGTGGTCCATAGAGACTTATGATT
CTTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTAC
ATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGG
CCCGAGTATAATTAACTCTAGTTAAACTAAGCGACGCTTCCTCACATACACGCGCACAGGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCACTACACC
TGGTAGCACTTCGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTACGTCATCGCACGAACGCGGAACTGAGAACCTTCCCATGGATACAGAGGTGCCC
ATGGAAAACTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCAACAGTAA
TTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAACGCCGACAGAGCAACATGGTGTTGCTCTGGGATTCATCATGAGGGAGCAGCGAGATGCTGC
TTCGTCTACCACGGTGTCGTCGGGGACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGT
TGGCTTGTCGAACTTGACACTGCCATTGCGGCTCGATGCATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAA
GTTGGGCGTATGGACGCCGACTCTCGGATCTTACGTGCTTTAGCACGTACGAGGGTTTCAAGAAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAACGA
GTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGATAGCACGGTACTTGGTCTCGAACATCGTGACC
AATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGGCTGAAAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCG
AAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCCCAGCCACGCCCGGTAGTGAGGAC
GGGAGGCCCAGAAACCATGGACCTCTCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGT
CACTTTGCTCGGGGGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTACCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGT
AGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGTCCCCAGTGAGGTTCATTCTCACTGCAAG
AACCAAGATGACAAGCCTGACCTTGTCATCCTGGATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACT
TTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGAC
CGAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGGCCTGGATCTGGACGATAAGTTTAACATCGTATTA
GGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTG
TTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATACCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGTACGCGC
GCAAGAGCAGCTAGCGTCGGCGTTGCCGCCGACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTCAGCGAATCAGGAAGAGTCTC
CGGCCTCAAGGGGCACGGATGACGCTGGCGAGTCACACGCCTCAGCAGTGGAGGCTGACGCGAATCTGAGTGGATCAGGTCTGGCCAATAATAAGAGCCA
AGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCC
AATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGTGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAATCTTGCAT
GCTGTCGTGCAGCCGGGCTGCACGACCAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTTGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTAAAGAAGA
ACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGATCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGATCGCTGCGCAAGTCT
CGGCCTGGGGCCGAGACGCTACAAGGAATGTCTACCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGCGCCG
GGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTT
GCATGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACT
GAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGATTCGTTGAAGACGAGTCCCTACTACGAGATCTTACGGG
AGTACGCGGACGTACTCCTGGAAGAGATTCCTGCGGAGCTTCTGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTATTGTGT
CACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGCGCGGGAATCGAAATCCCCG
CACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGGCGATACCGGCGCAGACAC
CGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGA
GAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGACTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAAC
AGGTGTGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATG
TTGAGATACACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGAT
ACCCGTACTCGGGTGTCTCGTCGGGAAGAACGATGTCCGCCCTGATCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAA
CTGCGGCAGTTCCTTGGTTTGGCCACGTACTTGTGCAAGTACGTGAAGGGCTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCG
AGTGGGTTTGGGCTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGTGTCG