Description :
From Genome Similarity Track
Location :
Scaffold_1222:825- 3853
Sequence
3028 bases(100 bases per row)
GCTTCCTGACTCCACCATACCCCGCGATCGTTGAATTCCGGATTATGGTGATCGGGTTCCGCGATCAGCGGTAGACGTGACCCCTGGTCCACTCGAAGAG
TCAGCCTGATCAGCGTGTCGGAACTGGACTTAGACCTGTTCTATCACCACTTCTCGAAGCCCAAGGGATACATATTCCCTGTCCAGCAGGGTAATCTTCG
CACTCCTCCGAAATTTTCTTGGTCATCCCAGCTGATCACGTCCACCAAGATCAACCAGTTCTACGATCAGCAACCGTGGGACGTGTACGATCAGATCGTA
CGTCCGATCTCGTTCAAGCCTTCCGGATGGTTTGAAATCTGGTCGAGGCGTATGAAGCTTTCGTGGATTGTCATCGTCAAGCTCTATGGGAAGCATCACA
TTTCTTGTGGCTCTCCCCTGCGCAACGTAAATTGGATCCTGAGTTGGCTGCCTTTGCGCAAGAAAGAAGGTAGAGACGATCTCGTGCTGGCCCCCGATGG
AAAAGAGTGTTGCAGCTGATCCTGAATGGCATGATCGACGGTCTTTGTGATCTGAACGTTTTGCTGGATCCCATGTTCCTGCACTTTCCCTGTCCGAACG
AGGTTAGCGTGTGGTATCCCGGTCTTTCCGTGCAGCGGACCAACATACCCAACTTGATCACCGCTTTGTTGATCGATCATGCTGCCGAACGTTGGAGGAA
CCAGTTTCGTCCTTCGATCGCCTCCCACCCTGGGTCATCTCTTCCACGCTTTATGGGTAAGTTCTTTTTTCGCAAGTGATTTCTTTGGTCTAGTCCCATA
ACGCGATCTCTCAATATAATTTCGTCTCACTTCCATTCGATCGCTCCCATAATTCATTTCCTTCCCTTTCCTTTTACTTTTTTTCATCGCGATCACACCC
TTGGTCTGCGATCATCGCACTCAATTCACATAAATTCCATTCCATCTCCATGTACAATCTCCTTGCACCCATTACGTCCATCCCCATCCATACAGCTTTC
CTGCATATACACATCCACTCAATCTCTCCGATCGTCGCTAATCTCTGGCTTCTTCTTCGTGCGATTGCATAACCTCGAAAAGGTTCCTGCTCAACCGATT
GCAATTGAACTCCTGCATCATAGCTCCACAGTTCAGATCATCTTCGTCAATCCAGGTTGGGTTGCAAACTCCTTCCATTGTATCAGGTACTGATTGTGTA
TTTGGCCATATCTAGTCTTCCGTCCCGATCGCACATCGATAATCTTATCCACTACAAATTCGTCGGCGTCAAGATCACCCTCCCAAATATCCCCCGGCAG
CAGTGCTTCGTCAAAATCGAATCGACTTGCCTCATTCAGCCTACTCGTAGGGCGTTCTGGGAACACGCGAACTAGCTTCAACTTAGAAACGTGATCATTG
GGAATAGCCGGTGCGGTGTACCCGCGATTTCCAACTTTACGGCGTGATTGGCGCACTTTCCGGCCACTCGGGAAGGTTTATGCCACGTATGGGCTAGCTT
CCGAGCGTATCGTTCCTTGGCTCGGTCTAGATATAACCAAACTCGCAACCCGCGATCGATATTCTATAAATCTCGATTTTCATTATGTCGATCGGCTCGA
CCTTTGATCGCAACCTTTGATCGGTCATTCACTACTGCCCACGCACGCTGATATTGGCGTTTATGCCATATCTCCACCTTCGTGCGTCTTGATCTCGGGG
TTTAGTGCTTCCCAACGATAATGTTGCTTCCAAAGTTGATCTTGGGTCCCAACCGCGAATCCGGTAAAACCGTGTGTCTCCGCGAATTCAATCATGAGCG
GTGTTGATCGCATAGGTCAATCGTTCTGCTTATTCGTCCCAGTCCTTTTAATTTTCATCCATGACATACATCTTGATCGATCGAGTCAGTGTCTGCACCA
TGCGCTCGTCCGTACCATTCGCTTGTGGTCTATATTCCATGGTGGCCCGCCGTTTTTGTCCCGCGATCCAATTGAACGCTCGGAAGAAATCGAACCTAAA
TTCCGGCTCGCGATCATGACATATCACCTCACTCGCACTGAATCGTCTGAGCACGTATTCTTCGTAATTTTCCGCGATCGTCTGTGCGGATCTGTACAAG
CTTGCTTTCGCGATCACATACCCAGAAAATAAGTCGACCCACAATAACAACTCGGTGTTATTTTTAAAAGATAGTGGCAACGAAGGGGTGTGATCCATAG
CTATAATCTGGAACGGGTACGTCGATTGCAAATTACCAGGTGATCCACTCCGATCACCTGGTCGTCCTTTTCCGGTTTCACAATCCACACACTCTCCCAC
ATACCGCTGCACACTTCGGTACAACCCACGCCAATGAAAGTTCGCCCTGACCCGTTGATAAGTACGGTCGAATCCTTGATGACCACCCTCCAAACTTGTG
TGGTAGTGGTACAAGAGATCTTGCTGTAGCTGCTCTGGAACTACCAGACGAGCCAGTTCAGTACGGTCTTCCGATTCGGTGGCTGATCTCGGACAGAAAA
ATAGCAATCCACTTTGGTCTACTTCATAATCCGGTGCGACCAGGGCGCAAACTTTGGCTTCAGCCGCCGATAATCTAGCCACATCTCCAACCAGATGTAT
CTTCAGACTGGATATCCAATTTTCTCCGTCTTGTGCTTGCTTAATGCGATCGATCCGTATCTGCTGCACCACCTCTTCCTGTAAAATTCTGGGCTGACAG
CGACTTCTTAGGGCTGATCTAGTAATAGCCACCACTTTGACTGCATGATCGACTCGTTCTGGTAATAGTAATTCGCCTAGCCGATTGAGAGCGATCCGAT
CCTCATGATCCTGATCCGAAATCACAACAGTTCATTTCTCTTGCCGTAGACCTGCACTCGCTAGCGGATCTGCACTCTGATCCCAATCACGCTTCATATG
CAGGAATTCATGGGCTGGTCACGATCGGAGTTTATCCATCGCTTTATGTCTCAGCAATTGCAGTCCTGGTGCCTTAAAATCGGTTTCTCCTCGCATTGGC
GGATCACTAAATTCGAATCTCCGCAGAT