Description :
From Genome Similarity Track
Location :
Scaffold_2833:825- 2751
Sequence
1926 bases(100 bases per row)
AGTCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCATAAATCACCAGCCTTTTCGGATCCTGTCCTTTTAGTAGATCCAAA
CCCAACAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCCTCCGCATAAGTGTCTCTGGCCCGTACGACTTCCCATCCGGGCAGTCTCCACAGCA
TTGCGCTGTATGCTCTTCCTCCACGTCGTACGCGAGCGGATCCATTGAAGATCAGGACGTACAGATCCTCATCCACTTGTACCGTCGGGATCGGGATCTG
GATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAAACTCCCAGGATCTCG
TCTTCCCCTTTCGAACATTTCATAATCTCCAGCGTCTAAGGTGAGAGTAAGGCTGCCCATTGCCCCAACCGTCCTTGTAAGCCGGCCGACTTGAACAACC
AAGCTAGCGTAGTGTGTCGAGTCAGGATCCGGATGGATTTTCCCACCAGCAGGTTATAATTGAGATCCAACACTCGCAGGAGCGCGAGTATCTCCTTCGC
CACCGCTCCGTAATTCAGCTCATTCGGCCTTAGCGTCCGGCTGACGAAGGTGACTGGATGACAGATCTCCTCATGTTCTTGTACCAAGGCTGCTGAGACT
GTCCAGTCACTGGCATAAACTATCACCGTAGGTTAACGTTCTGGATCGAAATGGCGGAGGATGGGCGTCGTCGCGATCCTGTTCATTAGCTCCACGAACG
CGTGCTGGGCTCGGATCCACCGAGGCTCCACCTTTTCCGAGTTCTCTTCCATCCAAATTGTATCCTCTTTCCGTTGGTCCCGGGGTGGATCCAGCTCCTG
TTTTAGGTCCTCTTCCGGCGTTGTGCTACTTGGATCCCTTCGTGGATCCGATATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGAAGTG
GTCATCGCAGCAAAATCCACCTCTCTCAATTCATAGAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGA
AGGATTGCATCACCCGTAACGATTGTGGGAAGGGCAAGTCTGCCAACGAGGACAGGTCCTTAGGATTCGCCTCCAGTTCCTCCTTGGAGACTCGATGACC
TAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACGCTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGAGATGTCACTCTCTCGCAC
AACTGATCTCACGATTCTGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAGCACAGATGGAGTCCCAGGATCCCCTGGCTCTCCTGCTTCGA
ATGGATCCACTTCCGTATGACCTTCCCCGGATCCACCCCTTTCGGGTTCCGGGATTCGGGTGAATCCGTAGAGGGCGTTATCGATCAGGCGTTGATAGAT
CTGGGGCACATTCTTCAATCCAAACGGCATCCGGTTCCATTCGAACAGTCCAAATGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTC
ACCACCCAGAAACCACTGGCCATATCTAGAGAACAATACCAGAGTACTTTATCCAAATCCTCCAATAGCTCATTGATTAGAGGCATTGGATACACCATCA
GTCGGGTCAGGCCGTTAATTAGCCGGTAATCAATACACAGACGTATATCCACTCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGT
TGAGAAACTGATGATTTTGGCTTGCAGCAGACCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCACCACCTTCCGCACCCTTTGAGCGATCGGC
TTCGCGTCACCGACATCGATGTCACA