Description :
From Genome Similarity Track
Location :
Scaffold_126:8247- 12735
Sequence
4488 bases(100 bases per row)
AAACCCTCGGTAAAAACCTCACTGTGTCATATGCAAAACTGAAGGCGATTGCGCGGCCCCCTTCCCAAACGACTAAGCCAATCTGTTGCCCCTGACTCAG
TCACGACGCACTTCACAAGCATAATATGCATCATATAACCTACACATCCAACCGCGTACTTGATCACTTCTAACAACTCGGACGGAGAAGAGAATGTTTT
GGTCTAGATAGATGTAGACCGAGGCCACAAATGGATATGCTTCACTGGGTGGGTCAGTAGGTGGCCATTCGATCGACTTAGTCGAGAGTGGACTTATAAC
CAAGTTCTTCATGTAGCTTGTCGCTCCTGGCCTTTTCCTTGTAGTCTCAGGGGTGTTAACCTCCTGGCCTTTACTTTACTCCCTAACCGCGTGGTAGGGA
GACGGCTTCCGATAGTAAGTCTTGAGGGGGTATTGCTACTCGACGAACGCGCAGGCCAAATACTTCCTGGGGTTCTAGCTGTACTTGAGTCTTATCTCGC
AACTGTCTTCGACGGGGGGGCCAAAGTATATTCCTTCCCGGAACAGTCGAAAACCGGCGTGTGCGTCGTCGACGAATAAACTGAATTGTTGATGGCGACC
TCCACCATCGGCAGAATCCGCTCCAATTTGTAAAGGAATGGACGAATCCTTGAAGGATCTCCTCGAGGACACGATTGGCGCGTCACGTCTGACCATCTAT
TTCAGGGTGGTCAGACGTGGACATCTTTAAGCGCGTTCCGAGTGTTTTGAACACGGAACACCAGAACTCAGCTGTGAACCGCGGGTCCCGATCGGACACG
AGTTCACGAGGCAACCCATTTAAGGCGAAAGACCGTGTTGATAAAGACACGGACAGAAGCCGATGCGTTGATTGATTCAGGTACAGCAACCAGATGTACC
ATCTTGCTGAAGCGATCAATGAACACAAGAATACCAGTGTTCTTGTGAGAGTCTGCGGGGAATTAAAAGACAAAGTCCATGGAAACGGATTTCCAGCACT
CTGTCGGGACGGGTAGAGGCTGCAACGATGCATGAAGGGAAGGACTAGACTTCACCCTTTGGCAGACCCCACAGGCCCGAATGTACTTGCGCACGAACTG
ATACTGGCGGATCCAGTAGAAGTCGCGGCTCAATGTGAGATATGTTTTCTCACGACCACGAGGTCCACCAACAGGTGCGTCGTGGTACATATACATGATA
CGCAATCACAGATCACCGAGATCTGGTACGACGACACGAGGCGTGTCGCCGGTAACAGCCGAACATTGGAGTTGGCCGTTGCGAACTGTACATCCATCCG
TAGAGGATCGATACACTAACGACAACTGTTTGAGGTTCTTCATGGATGGTTGAAAGATGATAAGTCAATCGCACCATCTCCGGATCATACGCCTTTCGTA
TATCTTCCAAAAGGGTTGACGACGGGACACTCGAAGTCAGTACCGCGACAGTGGTCGTACCAGTGTCGGGTGGCGCAGCCGGATCGAAATAGGGCCGGAG
CGAGCGTGCGTCAGCGACGACATTAAGTCGTCCTGGCCTGTACTCGACGGAGAAGTTTTACTCCGCAAATAATGACAGCCATTCGCCATCCGCTGCAAGA
GGAGTGGACTGTTTCCGGCCGTGCGTAAAGACGCATGGTCCGTAAAAACGATGAAGCGTCTATCACCTAGCAGATAGACTCTAAGCTTAACCAGCGCGTA
CTTCATGGCAAGGAGTTCCTTGTCACCGAAGGGGTAGTTGCGTTCAGCTGGTTGCAGCTGGTGAGTCTGGTAACAGACGACACGCGCCACATTATCTGCA
TCGTATTGCATTAATGCACAGCCGATTGCGAAGTCATTGGTGTCACCGACTTGTGGAATGATATGTCTTGATCTGCAATCGACAAAACTGGCGATCAAGC
TCTGCTTGATACCTTCGAAGGAGCGCTGAAAATCATCACTCCATACCCACTTCTTGTTCGTTATCAATAGACGAGAGAGATATATGAACAGTCATCTCGG
CGTAATTGCGTGAATATTTATGCAAATACGCCGCTAGGCCAAAGAGCTTTCGAAGTCCCTTGACTTCTGTAGGCACCGGCCAGTCGGTGATCGCCTTGAT
CTTTTCTGTATCGGGCCGGACGCCATGCTTGCCCACGATGCACGACCCAAGAAGTGGTATTTCGCTAGCACCAAATATACACTTCTTGAGGTTGGCTGGC
GTACAACTTATGCTCGCGCATTAGTGTAAGAACATTCCGGACGTGGAGTCGGTGGACTTCCAAATTCGTCAGTCCATCCATAGCCGGGCTATGGACGAAC
ACATCATCGAAGTAACTGGGTGCAAAGTCTCTTACTGGTCTCAACAGATTTGAAACACATCTGTTGAATAGGGCAGGGGCATTACTTATCCCTTGTGGCA
TCACCAGCCACTCCCAGAGCATATCGCTTGTGGTGCTCACTGCAGTATAGGGAATGTCCCTTTCGCGAAAAGGATCTAATAGAACCCATCCATCAGATCC
ATGGATGAAAAGATGGTACTCTTAGCTATACCATCTATGATGACATCTTTCCTTGGTATTGCTGTTTGAGCCGGTACCGTTGCAGCATTCAACTTGCTTA
ATGAATGGCCTTGCGCACACAAAAGTTCGGAGAGCTATGTGGGGAGGTTGACTCCCTCACATGAACCGCTGCAGAACGATCGGCAAAGAATTTGTCGACC
GCTAGTACTTATTCACGGGGCATTCCTTCATGACACAGTACTTCACACCCGGTTTCAGGTCAACTTCGTGACGAGTACCTTTGTCCTTAGGTAGCTCGCA
CGGCACTGCTTCTGGGAAAAACATCCCTGAACTCAATATAATCATCGGAGAGAGAATTTGTTTGGAGCGATTCCCACGACTGAGATGTATATCGCTCAAT
TGGTGTCTTCTCATCAAGGACACTCTCGACCATTCATGAGCTGCTGAGAAGCCTTCATTCTCGGCAAAGACCATTGCCGATCGGATATCGGTGACATACT
CGTCCTCTGGGACGAGTACGCAGATCTGCTTGGATTTGCCACTACGAAGATCACGTGAGAACCTCTTCTGTCCTAGGGTGGGCAATTGAGTGATCTCCGA
AGTTGACTTTGGAGGCGCGATCAGATCAAGTTTTTAGGTATCTATACTTGATCCGTCATTGACCAGGACATTTAATGTCGCCAGCTGAATTGTGGCTCGT
ACCTTCTGAGCCACGGTAAACCAAGGATGACATCAAACTTGTATCCAAGTCCAATACGATGAAGTCATCACCGTATTGAACTTCTTTCAGTGTATAGGTA
ACTTTCACTACACGCTCTATCACTGTTACGAATGCGCCTGTAGCGAGGCGTACCGTTATCCTCGTTGGAGGGATCTCTCGCTCGATGTATTTGAGCTTGC
TGTTGTCTAGCGATTGGCGTCGTACAAAGTTGTTTGACACCCCACAATCGACCAGGGCTCATAGTGACATGTCATTTGTCATTTCGACTCGTGGTAATGA
GGGGAACCTAATTACCAGATGCAGTAGCACACAATGATTGGGTGTCGGGAGCAATTCTCGTCAAAAGGCCTGCAAATTCAGTTGACGTTGCTGGATCAGC
AGATGATTTGCACCTACTGACCCCGACCGTATTCGGTCGTCCGTCACGATATAGCGTCTGCGCACCAACGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN