Description :
From Genome Similarity Track
Location :
Scaffold_446:8242- 12403
Transcript NameFunction/comments
Phyra_86070protein phosphatase 2C, putative
Phyra_86071GPI ethanolamine phosphate transferase, putative

Sequence
4161 bases(100 bases per row)
GCGCGGCCGGGAGCTTGCCCGGCGTCTTGATGGAGATGCCCTTGGGCGACGCCACATTGGGCGCCGCAGCCTCCTGCTGGCGGAGCTTGGCGATCGATCC
AGTCTTCTGAATGGGTCGGGCGGCCATGGCGGAAGATGTTCAGAGAGACGAGGGCCGGACTGGGACGCTGCAAATGCCAGAGTGACCTCGACGTTGCCTG
GCCGGCACGTCCTTTCAAGTAATTATAGCCGAGGCAAAAACAGCGCGAGGTGAACCGGCGTGAAGCAAATGGGGCCAGTGACCAGAAAGGATCGACAGGC
CTATCACGAGCGGTCGATGAGCGTGCGAGGCTAAGAAAAGCTTCAGCCAGGGACAGAGGCAGCTAGCTGAGCGGATAAGCCACGAGAGCTTGGCACAGTA
TCGGCGGACGCTTCCTGTGGGGGGCGAGACACGGATCCGGTGTTGCAGACTCAAGATACCAACTGCAACCTCAATGTAGCCATGTGACGTGCAAAAAACG
TAGCTTGACGCGTTAATCGCTATCGCTATCGTCCTCCGAGGACGACGAGAGGCTGAGCGAGATGGTGTTCGGAGCCTCTTCGTCGCTGTCGCTGGAGTCG
CTGGAGCTGTCGCTCTCGGCGGTGCCCTCGTCCGCCTTGTCGCCCTCGTCCAGCTTGCGCTTCTTGCGCAGACTCTCCACGTCGTCCACGACCTCGTCGT
CGTACAAAGGCGCGCGTTTCTCGGGCAGCTTGAACTTCTTGCGCAGGATCTCCATCGCGTCTGGAGGCAGCGGGTCGCCCGTTTTCCATGACTCGGGCAG
TGTGATGCCGTGCTCCGTGAAGAAGCTCCGGCCCATGTAGTGCAGCAGCGCGTCGAGCGGCAAGTCCACGGGGTCCCCTGGCTTCCATCCAGGTGGCATC
TGCTTGCGGATCTGCGCGTCGCTCGCACCCAACCCAATCGGAATGTTGAGCTTCTCGATAGCGTCGCTGCCCTCGCCTTCCTGCTTGACCCGCGCCGCAG
TGGACGTGTACTTCTCCGGGCCCTGCGTCACGATCTCCGCGACGATGCCACGGCTGAGCACACCCGCTCGCATCATGTGCTCCTGCGGCGCTGGCGGCAT
AAAGCCAAACATCGGGAGCTACATGTATACAACAACCCGACAGAAAAGCGCATGAGCAAGGTCAACCCCCCTCGCCACCTTCAAAACTCCACGAAAACGT
ACGCCAGGCTGCCACTCTTTCGGTGCCGACGTCGTGCCGGCAATGCGGTGTGCATATGCAACGATATCGCGAGGGTCCAGCACCACTAGAACCACAAAAA
CCACCGTTAATCCACTGCTAAAACAACAAGAAGAAAGCCAAGTGGCACCTTTGGACTGGTGCTTGGCGTTCTGTAGCACCACTCGGTGCTTCCTCAGCAC
GTTCGCAATGTCCTCCTGGGACCTTCTCAGCTGTGCCGCGTACTGCACGACCTTGTGCTTCTTGCTCTCGATCTCCGCCTCCACGCGCAGCAATTCCTTC
TGCGCCAGCTGATGCCTGGCCACTAAAACAACGACGTGAGTCTCTAAATCGTCTCCTCTGCTGCCTAGTTCCTCGCCAACTCACGCTTCTTCACGGCCAA
CAGCAGCTCACGGTCCTTCTCCAGCACCTTGTGGAACGTCTCGTTCACTGTGCGCAGCCTCGTGGCCGTGATCGTGGACGGCGGGCTGCAGGTTTAAGCA
TCATTTGAAGCGTCCAGAACGTGAGAATTACGCCGTAAAAACGTGTGCAAACGGTAGTTGGATACATACAGAGACGCCGTGTTGAGCGACTCCAGCAGCT
TGGTCACCAGGAAGCGGTGCTCGTGCAGCGCCACCTCCACCTCCTCGCGGATGCTCCCGCCCATGTGCGGCATTTTTGGCTCCTGACTTGGTGCTACAAA
TTAACCTTAACCGTTATTGAACACATTTCAGTTACATTTGTATTACAATCGTATCCATCACTTCCACTTCGGACAAGAGCTCGGCATGACGCAGCGAGTG
GGCGGCGGCCTGGCGCAGCTGCTAGTGCTGGGCGTGTTCTTCCACGCGCTGTACGTGCTCAGCATCTTCGACATCTACTTCACGTCCCCCGTGGTGCATC
ACATCGAGAGCGTGGGCTACACGGACGCGCCGCCGGCCAAGCGTGTGGTGGTGTTCGTGGCCGACGGTTGTCGAGCAGACAAGTTCTTCGAGGCCGAGCG
CGTGTCGTTCCTGCGCGACGTGATGCAGAAACGCGGAAGCTGGGGCGTCTCACACACGCGCGTACCCACGGAGAGCCGCCCAGGCCACGTGGCGCTCTTC
GCCGGCATGTATGAGGACGTGAGCGCCGTCACCAAGGGCTGGGCGGACAACCCCGTGGACTTTGACTCGGTGTTCAACCAGAGCAGCCGTGCCTTCCTGT
TCGGCAGCCCCGACATCGTGCCCATGTTCGCTCGGCATGTGCCACAAGCACTTGAAGAGCACTACTCGCATGCCGAAGAAGACTTTGCCAAGGGAGACGC
GTCCGAACTGGACGTTTGGGTGTTTCGACGTCTGCAGAAGCTGCTCAATGAAGCGACGGAAGGCAGCGATCGGTTCGAGCAGTTGCACGCGGAAGGGGTC
GTGGTGTTCTGTCATTATTTGGGCATTGACTCCAATGGCCATGCGCATCGCCCCAACTCGAAAGACTATCTGAACAATATTGCGCTGGTGGACGAACTGG
TGGACAAGACGCACAGGATGGTGGAGGACTTTTATGGCTACGATGGACGCACGGCGTACGTGTTCACTGCGGATCACGGGATGGGGCTGAAAGGAGCGCA
CGGGGACGGAGACCCGGCGAATACACGGACGCCGCTGGTTGTCTGGGGGGCAGGTGTCCAGGGCCCTATGAAAGCGGAGGAGAATGGGAACTTTGAGATT
GATCTGCCGACGCAGTCTCGAGCGCAGGTTCGAGCTCAGCTGCAGGCACAGGAGGAACAAGAGCGAGCGGCAGTGGGCGAATGGGGCGCGCTGGGCAACT
TGGTGCGGAGGGACGTGATGCAGGCTGATGTGGCACCACTCATCAGTGCGCTGCTGGGACTGCCGTACCCGAGAAACTCTGTCGGAGTGCTGCCGTTTTC
GTACTTGGCCAAGGGAGCCTACCGGGCTAATGCTGTGCGCTCGAACGCACAGCAATTGTACTTGCATGCACTGCGAAAGGAGCAGGAGAAGCGGTCGAGG
ACATTGCTACGCTTTGTGCCGTACGGACCGTTCCGCGACCGTGTGCCTGAGCTCTCGAAACTGCTTGCTGAAGCATACGATGCCAGTATCCAGAGCGACA
ACGACTCGGAGGCCTACGAGCGTGTGGAGGAGCTGAGCCAGGAACTGATTGAGATCTGTTTGGCGACTCTGGAATACTTTCAGAGGTACGACTGGTTTTT
CCTGCTTAGCGTCGTCGTGCTGGGTTACGTGGGGTGGATGCTTGTGGTGGGGGTGGCCTACTTACACCCGCGAGACTTCAGTTTAAAGTGGTTGCTTGGA
GTGGGTGGCAAACAGCTTGACATCAAGCTGAGCATTGTGCTGTTTGCATCTTTTGTATACCTGGCTCTTGAAGGTTCGCCAACTACGTACTACCTGTACG
TGCTGTTCCCCCTTCTGTTTGGAGTTTTCACGTGGAACCATGCTGATCTAATTCAGCAAGCCTGGGCGTCAGGTGTGAGTGAGAGCAAATCGAAGACCAG
CTGGAAACGATGGGCAGAGTGCGCTCTCATTTTGCTATGTCTAGAGCTGGTGGTGTTTGGGTACGAGCGCCGCGAGATCTTTGGTGTGCTCTTTTCATTG
CTTGCACTGTGGCCATATGTGGGAACTTCCGCAGATGAAGGTGACGGTCAAGAATGTGGATGCGGCTGGACTGGAGGCTTCCCATCACCGAGTCGCTGCT
GGACAATTAGCTGTTTACTCATTTCAGTCTTCCCATATTTGCCAAGTGAGTACGGCGAGCACACCGCGTTGGTGAATATTGGCAGTCTCCTGACAGTTTT
CTTTACCGGTGCCGTGCTGACCGCCTTCGGGTCTAGCTGGACGAACTCGTTGTTTATCTTGAATGCCTCGCCGTTGGTGCTCTCGCTACTCACGCTACAT
GCCACAATGCAGTATCTGGATGGTGAACGAAGCAAGCCGCCATTATCGCTCACAGTAGCTA