Description :
From Genome Similarity Track
Location :
Scaffold_37:82406- 89911
Transcript NameFunction/comments
Hyaar_Emoy2805271hypothetical protein
Hyaar_Emoy2805272hypothetical protein

Sequence
7505 bases(100 bases per row)
AACGCTACATTATCGGCTGATTTATAGACATGCCTTGACGGTTAATATCGCTATAACCAGTTTTTAAACATCTATTTGACCTAAATCAGTAAAGTTTAGA
ATCGTTCTTATGTGTTCTTTAGCGAATGATTCTATCAAAGCTTTGCCTGAAACGTTTGCGGACTCGAAGCTTTTACGTCCTCAGTTGCTATCAATCGCTC
ATTCTATTTTAAGGAAATTGATAGGAACACACACACCCTTTGATGCGTACGCACCCAGTCAATCTGTAAATTAATTGTTAGTCACAAATTGTAACGTAAA
TGCATAAAAATCTAAGTTATAACATTCTAAGAAATTAAACAGCACTGCGCATTTGATCAGGAGAAAGGGGTGACCAAGATAATGCCAACTGTGCTACTGC
CTCCAGCGCACCTTCTGTCGCTTGAATTCCACTTCATTCAATGCCAAGAGCGCCTCATATTGCCGAACAAGGCTGTTATTCATCTCGGTGAGAACTTGCA
CCAGCTCGTCCTTATACAGACCCGTTGTGATCACAAGCAACGGAAAACAACACATAAACTCGGGCATCAGTCCATACGACACTTCGGCGTGAGAGAGTAA
CTGGCCAATCTGATTGCTATCTTTCAGCCGCATGTTGGGCATCGGAGCACTAAAGCCAGTCGATGACTGCGCTGTACACTGAACACCTGTTTTTCCAGAC
CAGCAAATGCGCCACCGCAAATAAAAGAATGTTGGTCGTGTCAATAGTAATGTACTCGCCGCGCGGGTTCTTGTGACCGCCCTTTTCCAGTACATCTATC
GTACTTTCTTCCAAAAGCTTCAGCAGCGTTTCTTGCACCCCTTCGCGACACGTCGAGTGCGACACTCACATATTCTCTCTTCGTGTAATCTTGTCAATCT
CGTCAATGTACACGATACCACGCTGATAGCTTCATTGTTGAAGCTGGCGGCTTGGTACAGTGTGAAAAAATACGGCTCGACATCCTCGTCCAAAGACCCA
GCTTGAGTCAAACACGTTGCATCAGCAGTAACAATCGACACTTTAGCCAGTCAGGCTAGCGTCTTGGCCAGCAGCGTCTTCCCCGAGCCTGTGGGTCCCG
CGAGAATGATATTTGTCTTGTCCAGCTCGACACATTCCAGCGATTTCAACTTGTCCTAGACTGCAGCGTCACGCGCGTGAGCAGCCGCTGGATTGGACCC
AGAAGAGTTAATCAGCGTCTGGCGGGTCGTTCCTTCAAACTCTGCTGGGGTAGGGTAAATCTCCTCCAGCAGCAATCGTCCACCGAGCATCGACCGTCGT
GTGTCGCCTGCATCATCTCGTTGGATTGTTCCCCTGTATTATCTTAATACTGCTCATTGGCTCGGCACACGATGCTTCTGCTTCTCTACTTGCTTGCAGC
AGATCCAGCTTACCGTGAGACCTTGGAAATAAGCCATCGCACATTGCAGGTCTGCATGTGTAAGCGTTCTACCAGCAGTAATGTTGGTACTGCAGCTAGG
TTTAGCATTAATGTTGCATGTTCAAAGAGTTTCCCGACCCGCAACGGTCTGAAGATCGATGACTTAACAAGTCGCCGTTTTTTAGTCTGGTACAACGCCA
GCTTCAAAGCATGCAAGACGAGTCCTGGTCATGGTCGATATCGCCGTGCTTTTTAATTCAGTAATTTAGATTCTTATGCATTTACGTTACAATTTGTGGC
AAGAGAATAATTTATACAGTTTGACTGTGTATGTACGTATCAAAGGGTGGCTGTGTACAAAAAAATCCGTAATATAACTTAGATTCTTATGCATTTACGT
TACAAATTTGTGGCAAACGATTAATTTAAATTCCCACAATATAACTTAGATACTTATGCATTTACGTTACAATGTGTGGCAAACGGTTAATTTACAGGTT
GACTGGGTGTGTACGCTGAAAGGGTGGGTGTGTACCCATCAATTTTCCTTTTTAAAGGTCGACGCCTGTACAAGAGAAAGCAATCCTCATTAAGCTTTCA
TGCGAAAGTTTGTGCGCTAGTGAGTGGTAAGACTGTTTCCGTATTTATTATTCATTTTGTGTGTATTCGAATCGTTCGTTTTGAGTGCACACGACGCGTG
TTACAATTATATGTCCTGTTCGTTACTGAACAACTTCCTATTTTCCTGTGCTGTTCCGGATTTGTTAATGTGCAATGTAGGTCCTCATGAGATCATGAAG
GAGGACATTAAGATGGTCGTGCACAGGGAGCTTTTGACAAGCGCACATACATATCGAGAACGGATTCCCCTGTTATTACGAAGATGTCAAGGCAATGCAA
CAAGTGAGATACTTCTTTACGATTATCCAGTTGCTAGTTCTGCCAATGAAGCCGAGTAAACTGCATGTTCGTGTAAGTGAGCTTCTATTTCAGCTATGCA
CGAGTGATAGTGCCTACAAAGTTAATAGACTCGTACTGAGGAATGCAATCAAAGTTAGGTGTTAGTGTTGGTTCTATTAAACTTCCACATCTTTGTGCAT
TGTGACCCACCCTCATGCGACGGCCGCATCTTCTTCGCAAATCCTTACGAATTTATTGCATCAGTAATGCTGATCGTTGCTTGCTTTGGTTCAATACGAT
GAATTTACACTCACTCCTTACTCACTCACATCTTTGTATTCTAAGGACATCGCTTACTGTGGCTGGAACGCCGACAATGACGTCCACCACACGACAGTTT
TGCGCAGTTGTAAATAATCACGACAAAACTGAAATTCCAAATCCAACTGATGTGATATCGTTCCCTCTATTCTCGACTCATAATCAGCCAATCATGTAGC
ATTATATCAAACTGAGAAGATTTTACCAGAAAACTGAGGGGAGATTAACGGTTCTCTAAAATTAATGCCATGGTCAAAGTAATTAGATCAAATATGACTA
ATTTGGACCTGAACGTACTGCAAACGTTTCCACAACGAAGTCCTTGTCATTGTCTGGCACGTACTTCTTACCCACAAGCAGTTCATTCACCAAGCACACA
CATCGCAAATTACCCATCTTTTCTTGTACCAACACTTACGACGGTCATGCGGCAATGTAGCACTTTGCGCCAAACGTGCAATAATATGACCTACTCGTAC
CTACATCGTCTTCAAACTTACTTATAAATGTGTACAGTCTAGTTGATGCCCCTGCTCTAATTGTCCGATTGTGTCTTGATCCTTTTAACACACACTAAAG
ATTGCGAAACGATAAGAAATTGCGACCACACATCGACAAATGATCCCTCTCTTGACGATACGTATCCATCGGTGAGACCGTGACTATCGGGTGCGCAGAA
CTTCACTTTACGAATGACGCACAGACTAGATTTGGACTATAACTAGGATGAGAGGTTTAATCGGGAATCGGGGAAAATCGAATATTCATTAGCTAGAAAA
ATGGGAATGGGATCAGGTGCGATCAGCGAAGATCCCGATGACCATATCTCCCCTTTTCACCTTCCCATCCCCCCTCATCTGGTTTTACCAGCATTGACCA
CCCAGTGCTTGCACAATGAGCGATTGGACGGTCACGCGAAAAAGGACTACAACATGATCCGATACGACCAGGACACGACCCGTGAATGTTATAAAATACG
ATATCTTTTTTCAGCCCTTCGAAAATGCATTGCTATGAAAAGAACAACACAAAGAGAGAGAGAGGCAGAAGGGTCTATTTAACCTTTATAGTTGGGGTCG
CAGGATGTCTAATATTTCCTAAGCCTGGATAGTATCGCCGGTTCCTATGTCGAGTCCGGTGATTGTACGGGGCTTGTCACCTGAGATGACGGCTCTCGGG
GTTGCCTGGCAAATTCGCCGTGGAAGGATAATAGGCGTGCGCCAACTATTTTCGTGTCGTCCTGACGAAACTCGCGCTTGGCTACAGCACCTAGCTGTCG
CATCCCGGTCTCCCAGAACTCCGTAACACTGCCTGCGATAGAAACCTCTTCGCGGACAACACCGTCCGATTCCGCGTGGTTCATAAAGTCGTAATACAAA
TACTGCTCATGACGTGCCATATTCGCGCCAAAACTTGTGCGTATTCCGTTTCTTCGTCGAATCGATGTCGTCGATGTCTTCCTTTAGACAGTTTCGGTGC
TGGCGTCGTGCACAATGTGCGAGGAAGCTGTGCAAGCGGCTGCGCTCCCAGCATTACCCGTTCCAGTGACAGATGAGTTTCTGCCAACAATCCTGTGCAC
ACGGGCATGACTAAAATGTGCTCCAGTGTTTCCTTGGCGTCCCGACAGCACTGCAACTTGCGACATCTACTATCGAGTTCGCGTCCTGCAAAGTAATGAT
TGAGTTGTCGCGTTGCCCCCTGTTAAAGAACCCACACCTGGTACTCCGTGGGTTGGTTGTGATGAGCCCAAATATTGGATGGTGTCTGCTGTAACGCCTG
TGCCTGCCACGCGCTCGATTGCGCAGCATGTCTGAGCCGCTCGACAGTTGTATGCAGCCCACTGTTTGCTTCTTAAACCAATGAAACGGTTGTTTCGTGA
GAGCCGAAAGAGCGTGTGTATTCGCAATGGAGTCCACCACGCTCCAGAGAAAACCGTGAAGGAGCAATTGTGCTTGAATAACGATGCATCCCGAGGTGTG
GCTTCTTCAAATCGTTGCGCAATCCTCCGCTGTCTGCTGAGTTTTTTCGTTAAATGCTGCCAGTCTCCAATGAAGTCCATAACTTTCTTGCTCTAACAGG
ATGGAACTCTGACGGTCTCTAGTCGCTTCCACCATGACCCCTCGGACCTGGCCCGATGAGGAGTATTCCCAAAGATATTTATGTTTGAGCGCCGGAGGGT
GCCGCAGTCTCAACCTTCGTCGAACTTGTAGCGCTGTGTCAATGTCAAAGTACGGTGCGGCCAATAAAATTGTCAGGCACCAGAGACGTAGCTTAACTTG
TTGATACATGCTAGATCCTGTCATTGGAATGACAAAGGAGTATGTCTGAGCAATAATCTGTTGAACTTTTTTGCAGGTTTGCATTTGAGCAAGGCTGAAT
CTTGTCGTACTTCTGAGATGTTAATGGCTTTCCGTACTGATCCACAATCCACGGGTTATCCGTCCAAGCGTATGTGGGCCAAAAATGTTCGTCTTCAGGA
GTCAGCAAGTTGGCGTGGGTAGGGATCGGCTGCGCGAGCTTTGACACCCATTCCTCTGGGGTGTACCATCTGATAGCGGTGTTAGTCATGCTCCTGTATC
CCTCAGAGAAGTCATATCTCCTGGCCTCCTGATTGACTGACGTCGGTGCCATCCAGGGACCAAATAAATGCAATAGTGTATTATCTGGAGTTTGTTGGCC
TGGTGCGAGCCGTCGTGGCATTCTAGTGAGGGCGGCCGCCCTGCTTACCGTACCAGCGTCCCGCCTCGAAATGCTCATGTCTTCCAAGCAGAAAGATAGA
TGTCCTTGCGATAGGAAAGCCATATGATTGCGTGTTTGACCCTTTGAGTCTTGGATGCTACCTTAATGGATGCTAATCCCACACCTCCCGCTTGTTGCGG
TGTGTGTAATAGCGCGGGATTCATCTTGTGGCGAGAAGCCTCCGCACTTGTAGAGTGTCATCATAGAAATTGCTTTTGTATATACCGGAGTTGTTGTTCA
GCCCATGGTGGGGGTTCGAACACCGCTGCAGTGAATAATACCACCGGCAACATAATGAAGTTAAGCAGCAAGACGCCATGTTCAACGCTGGTTGCGCGCT
GAGTCGCCATTGCTAGGCATCGTTGGACGTTGGTGATACGGGCAGCCAGTTCACATCTTTCAGATCCCCCGTCCCACTGCGTACTCCAAGTATCTCGTCG
TGGCCCCAGGTTGGAGTACCAGTATGCCAAAAAATTCCTCGCGTTGCACCTTCCAGTTAAGAAAAACCAATTTACTTTTGTCAGGTTGCACCTTCAAGCC
AGATAATCGCCCGAAACCCTCGATGATTTGCAGCACCCGAAGAAGTTGCCGCGCCTCCTGTAAAAAGACCGTTGAGTCGACAACAAACGCTGAGAATTCG
GTTCTCTCGCCGCTCTAGGTATACGTAGCCCACAAATCCCGGCATCTTGTTGAATAGCCAAAGCAAGGACTTCCGCCGCGACAAGATGAAGTATCGGGGC
AAATGGACATTCTTGCCTAGTGCCCGAAATTACCACTAGCAGCTATAATAGTGCTCCATTCACCACAAATTGGGCAGATGTGCCGTCGTGAAAACTCGTT
AGTTAGGTAACAAACTCGGGAGAAACTCCAAAGCGCTGGAGCGCCAAGAAAATAAAAATACGGGCGACCGTATCGTATGCATTGCAGAAATCTAGCAACA
GGATAACCTGGCTCATCATGGCCGTAACATCTGGCTCGGCGGTCGACGACGTCAATACTGCCATCATCATCATAACGGTCTTTCGCATCTGTCTTCCATG
GACGAAGCTTTGATGTGAGGCTCCGATCAATGTCCTTAAGACTTTTTGCACTCTCGTAGCAATATTTTAGTGAATATCTTGTAACCAGTCTGCAGGAGAG
CGATGGGCGGTAATCCATCGCATCATCCGAGTTGCTGCGCTTGCGCAGTGAAATGATTAAACCTTTCAAAAAGTACGGGGAGGCTTGCCTCCCCGGAGTA
GCTGATTGCTGAGAGCTAATATTGTTGGTACCATGAATGATTGAGTTTCTTTGAAAAAATCAGTTTTGAGGCCATCTTCTCCGGCTGCTTTGTGCCTGTT
AAGTGCCGATATCGCTTGGAAAACCTCGTCCATAGAGATAGTGCGCATTATTTGATCGTTTTGATGGACCCCCATGCGTATGGTGTCAGGTATCTTCACA
AATGCGTCAAATTCGGTCCCGAGATGCGCAGACGACGCTGAATTATGTACAACGCCTAAAATAGGCTGCCACTCCGACGCGAATCGGTCTGCGATCGTTA
TTTAGCGTCTGAAAAAAGCTTCATTGAGGTGACGTATTCGCGTAATGGTTTGATAGATTTCAAGTAGACACGTGCTTAGTTTTCCAACGAAGTTGCTCCT
TCGTTCGTTCCAACCATTTTTCTTTTTGTAATAAGTGCTCATCCATAGCCTCTGCCACTTTGACTGCTTAGTGGCCTTCCTCGAGTCAAAATGAGGGTTT
GACTATGCGCTTGAATTCGACATATTACCGATTTATGACGGCGCTTCTCTCGGGTTCGGACGCGCTGAATGCACTTTACGCACTGCTACACTGTACTATC
CCACGTCTATCCGGTTACTGCATAACCCACCCGTGCAGCAGTTAGACCGTTCAATAAATTCTCGATGACCGGACTGGACTGAGCTGTGGGAATAGGGTAC
ATGACCGGACGCTGTTTCCGTCGAGAACTCTCTACGGGGCTGGTATCTTGGCGATGTAAGTGCGCACGTTGATGATCTGACCCGACATGCGGTTACTCGA
CAGAAAACCATTGTACAACGGAAGACCAGAATTGTGGAACGTAAAATCGGTCGATACGACTGGCCGGGTCCCTTCCCCAGTACGTAAAAGAATTAATTAG
GTCCA