Description :
From Genome Similarity Track
Location :
Scaffold_79:824- 4454
Sequence
3630 bases(100 bases per row)
GCTGATCCTCGGCGACGACACTGGATCCATAGTGTGCGACCTTTCTCCGGTGATGGACTTGACTCTGACGAAGAGGTCCCGCGTCGCTGATACTATGAGA
TCCAATTCTAGCTAGAAGATATCCTCTGCATCGAACGCACCAGCGACGATGCCTGAATCCGTAAGCAGACGTAATTGATCCTTGACCACCACTAATTTGT
CCGCCGTTTTCTTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAA
AGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACGCTGGAGCTTGCATCTTCTTCCGC
GTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGACTTGACCTGTGAGTCTGCAAATGCATACC
GTTTCGCCTTCACTTTCCCGTGTTTTGTTAGCGGATCTTAAATTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGACGATAGAGAGGTTTCTC
TTCTAGATCCGGCTCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAGGACTCTATCGATCCGCGGATCTTGCTTCATTCAGCAGCGTCTTCGTCGATCCG
ACCTCTGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAACGATCCGGGCACGCGCA
CCATTGTAGAGTAGCGGGATCAGCATAATCTGCGAGATCGCTGGATCCAACTTACCAACAACGCCCAGACACCGACTAACGGAGGGGGGCCCCGATAATC
CGTGATCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGGTCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGCGATGAAGCTTGAGTG
TCTTGACGAGACGTGTGGATGGGGTGGAGCAGTAGTGGTAAGAGCTTCACTCTGCGTCCGTAGATGCTTCTGGATCCTAAGCGAATATTCGAGCTTGGTG
GATCCAGGGCTTAGATCTGGAATCTGGCCGTAGGGTTGCCTTGCGGGTGTGGTCCCTTGCCTTAGATTTCCTTTTCGTCGTACTTACCGCCTCCTGTGAC
GGTATCTTGAGAGCTGAGAGACTCTGGGGTATAGCCGGCCAAGTAGTAAATTCGGTTAACCTTGCGGATCTGCACGTGTAAAGGAAAGCTCAGTAGGTTG
TAGGATCTGGCCAATATATTATCCAGATATCACTACCAGTACCATATCCGCAATTCCCAACCTTCACCGAGCTCGTACCGCCAATGTAGTTCCGATTCTT
GAGAGGAGGAATGTACTTGCGTGATACTGTGCAAATTGAAGTCTGTATTGATAGTTAAGCCTATACCTGCCTGGATTTGGATTTCTGCCTTCTATGTCTT
TTACCTGCTAAATCCCCTACCAGGCTCGGCTGCATGTTCTTTTCTCCTTGGTTCATCACCCCAGCTATATTAGCATCCGATCCACCGGATTCACGGCGTA
ATCAAAATGAGGTCACCATATTATGGGTACACTATTCTGGATCCAGGTCACTTTGATCCACCTTACTGTAAGTGCGCGCTTCATCATGGATCTGAGCTCT
CCAATCTTCCAACTTCGTCTTACGACTGTCTGCGATTTCCATCACTCCACGAAACTTCGAGATCCGTCGCATCCACCATCCCCATATCCTGGATCCAGGT
CACTCGGTGTGGGATCCTCAATTTCTTGGATCTGAACTTGGCAAAGTGGGATCTGAGACTTATAGCGGTGGATCTCGCCTTCTCATTTGTCGCTAATATC
CGATCCACCTCCAGATGACATCTACCGTCTTTTTCCCATGGGATCCTCACCCGATCCACCCGCACATGGTATATCCCATAACCCCTAGGTATAATCGGGT
GAGGTGGATCCGAGTCTCCACTTGGTGGATCCTGCCTTCCCGTACGTTATCCATGCCATGTCCATCGTCGACCCATTTATGATGCCGCTTTACCTTGGCC
CAATTCACTTCGAGCAGCGCGGATCCATGCCGGGCAATCCAGATCCCCCCTAATCACCGGGTGTTATCACTAATCTGGGATAGTGACTCCTTGTCAGATC
CAGTCTCTTATTTCTGAGAAAGCGCTTTACCACATTCCACCTCTGTCAGGTCCTGGGGCGCCCGCAAGGGTTGCCAGGGTACCGAAGCATCCAGCAGATG
CTTGGGAGTCGTCGACGTATATGACGACTCCGAGGTCGATCGTGGCGGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAA
CATAGTTCCACAGACAGCTGCAGCTGTCACGAACGCTGGTAATAGCGTGCTCAAGGTGGGTAACAGAGCTCCACACACGGTCGCCCAGACCGTAACTGAA
GAGGAAGACGTCAGATGCGCTTCCTGTGTGGGTAACAAAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGGTCACGCTTCCTGTG
TGGGTAACATAGTGCCACAGGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGGACACGCTTCCTGTGTGGATAACACAGTACCACACGAGCCCAC
GAGTGCCTCGGACGTCGGCGCTCCGACATCCCCAGACATGGGTAACAAAGCTCCACTTCACGGTCACCGTCGACGACGACGCCGCCGCCGCCAAAAGTCG
GATCTGAACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCAAATCTTCG
ATGGCGAGACCAGCTTACCCGTCAAGGCATCTGGTGTCCACTTGAAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGAC
TTTTTTGGCCAACCTCAAGGCTGGGAAGGTTGCCGAGATAGTGCTCGTAAGACCTGAGACCACTCGGGAGGAGGTGAACTCCTCCTCTGTCTTAGACGTC
CTGGAAGACTTGAACAAGCAGCGTCAGACGCGCTTGGGTTCCGAGATCCTTAAAACCCCCAAGAATCCAGTGTATCCTTTGGTGACGGAGTATGCGGACG
TGGTGAACAAACATCCACCGAACCAACTCCCACCAGATCATGACTCGAGCGTGGTAAAGACTCTCTGTCAACTTGTCATCATCGCACGTTGCAAGAAACC
GCTGTACGTGTTCTTTTGCGTCGCGACCACTCTTCTCGAAGTGTAGACGGGCGGTCCGAGCGTAGCCATTCAGCCTGTTTATGTAGTCGCACAGATGTTC
GTTACGTTCCCGCTTTGCAGAGTAGTAACGGGACAGTGCCGTCTGCGTGAACTGCGAGCAGTAATAGCGGATGAACGCATCGCTCAACAGCTTCCATTTG
CGCTTCGTCTTCTTCGGAAATTGACGGAGCCAATGGATGGCTCCGTTCCGGAGACTAAGCTCAAATGGAATGCACCTTTTGTCGGCGTCTGTGTGAGTTC
CAGTCATTTCGTAGACAAACTCACGGAGCA