Description :
From Genome Similarity Track
Location :
Scaffold_4374:824- 2278
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4374-snap-gene-0.1Conserved gene of unknown function

Sequence
1454 bases(100 bases per row)
CGCGTGTGTGTGCGGGGGCTGGATGGCGGCGAGAACAGGAGCCGTGGCGATTTCCCACTGGTCGGTGTGCCACTAGCGGCATCACCATTGACCGGAGATG
GGACACTAGGTGACTTGGGTACGCCCGTCCACGTCATGGCCTTGAGGTAAAACTTGGCAATGATCTCGGTTGCAACAATACTGCGACGATACCTGTCCGG
GCTGAGCCCCGCAGATCCAAGCGCTGTGGTGGTGCGCTCGGGCATGGAAGTCGCGTACCGGAAGACCGTCGTGATGCTTTCCTGCTTGAGCAGCGTGATC
TGCACGGGCGAGAAGCCGCGCTCGCGGCGTTGCACTTGTGACACGACCGTCTCAATGTCGTAGCACGCACAGAAGACGTTCTGAAGCACATGCGCCTGGC
GAAGTGCCTCGGAGTTGTGGAGCGCCGTCGACGTCGAGATGGCGTCGCGATACCCAGAGACCTTCCGCATCAGACTGGTCGACCCGGCGGCAGCCGCGGC
GGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCGCCGCGTCCAGAATCGACGGCGACGGGGCCGCCGTGTCATCCTCCGAATCTGAC
TCCGTGTCCACGAGACACGTACACTTGCGCGAGCCAGAGAGAGATGGCATGGCTGATGATCTCTTCGTTATTCTTCCTTCTTTTATCCTCGGGCGTGTGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGGAGAGGGATGAGAGGAAAT
GTCTATGGGGCGAGTCACGGCCGCGTGGGTGCCGCGCGGTGAAGCCAATAAAGGTGACGACAGCAGCGCCTTCCCCCGTTGTCGAGTTGCCGTTTCCGCG
CAAATGGGGAAGGAGATTTGGGTGCGGCACGTCAATTACCTCTAGTAGAAGATATCGAGACACTTGGTATACGATAAGACAGGTATTTCCGTCAAACCAG
TGCGTAAAATACAGTAAGCACTCAAATAAGAGACCTGATTTCAGGGGTGCTACTTGGCTTCATCACGAACTGGAGTTCTTGGGCTTGGGTTCACTTGCGT
GCTGGAGGCCAGTCCTCCATCGATCCGTGGCATTTGCTCCAGAGGAAACTGTCGTCGCCACGTCACGGTTCAAAGCTGAAAGGGAGCGCGTGCTGAACTC
TCCGAAGGCTTATCGCTGATCTGTTCAGCGACAGTTCAGCATGCCTCCAAGAGTTCTTTTGGTGGTCCACTTCCAGCAATGTTCTGATNNNNNNNNNNTG
ACAGTTCAGCATGCCTGCACGAGTTCTTTTGGTGGCCCACTTCCAGCAATGTTCTGATACCGAGAGCGGCAGGATCAGCTTTTCTCGGGCTGTAGAGAGT
TGTCCCGATGTTCTGGTGGCCGCGCAAGCTCGTCGAGGGCACCGCCGCTGCTTC