Description :
From Genome Similarity Track
Location :
Scaffold_13:823874- 826084
Transcript NameFunction/comments
Phypa_INRA-310PPTG_07906eukaryotic translation initiation factor 1A
Phypa_INRA-310PPTG_07907hypothetical protein
Phypa_INRA-310PPTG_07908hypothetical protein

Sequence
2210 bases(100 bases per row)
GGCAAGGTGGACATCATTCATAAATACAACGCTGACGAGGCTCGTAGTCTCAAGGCCTACGGAGAGCTGCCAGATAACGCACGTATTAACGAAACGGCAG
TGGACATGGCCATGGAGGGCGACGGTGAGGACGACATTGGTTTCGACTTCGACGACATCTAAGCAGGCAACAGAGAAAATACAGACGACTTGCGTTGGGT
TGCTATGGCGGTCTAGAGCTGCTACGCAATCCAAGAACAGACGAGGAGGTGGGAGAGGGTTATTGTACCTCTTCTGCCATGCTGTCGGTCGCTGCTGCTA
GTATAGCTAGGTGGACAGAGAGAGTGAAGTACTCGCTCGGACGCGCGGATAGAGTGCGAGAAGACCGGGTGGTGTCGCCTGCAATGCGATGTATTCATTT
TGTGGCTCGGATCGGACTATTCTTCTTGCTTAAGTTGCTGTTGTGTATTATTAGAGGCAAGGACGAGTGCTGTTTTTGTCAGGGTTCATGGCCTCGGCAT
GAGATGATGCAGTTGATGGCGCCAATTTGGGGCGAGTGAAGCAATAATTGTGATGCCTCCGACGAGCATGAAGGCTGTTCCGATGTCGTCGACGGCTGCA
CCTCGTGCTGCGGTGCCAGTGAAGCCGGAGCACAAGGTGAAGATCGACGTCGACCCGCAGGTTCGTCAGCTAAAGAAGGCGAGTTCTCGACTAGAAGAAG
ATGGAGAGACTGCGTTAAGTCCGCGGGTCAGGAGGCGCTTGTCGGACGCTCAGGAGAGCGCTACCATCTTCAGCATGGGTGCGTTTGCGTTGAGTGGACA
TTTCTAAATAGGATACTGACAATGTGTATACCTCAGTGTGCGAGCAAGGCGAAGTGATCCAGTGGATGGCAGCGTGTCACCCGGAATTGACAGCATTTGG
AGTTGATTTGGAGCGGCGTGGGTACCGGACGCTAAGCAGCATCGCGTTCCTTACTGAAGAAGACGTGGAGAGTGTGGCAAATCCGGACTTGCGGCAATTA
CTGCTGACTACTCTCACAAGGCTGCGGCACGAATTGTTTCGCATGTGAAGAAGATCTAGCAGCTTCAATATAGAAAACATATTTTGCGCAAATGATTTAT
TAGTTTGTGAGGTGGGCTCACTCGGTTGCTACAGCATCTTCAGCATTGATGGCAACGTCGGCAGCGCTAGTATTCGGATCAACACTGGTAGGGAGATCTG
AAACTTCACCTTCATGCGCTTGATCGCTGATGCTATCAGCATAGTCAACATAAGACTGCTGCTCTTCTTGCCAAGGTACTGAGGCGTCTTGATAATAATC
GCTGTATTCCGCTGCATGTTCAGCTACGAAAGGCTCGCTCCAGTCTTGCTGAGTATCGCCACTGTATGGCGTTTCCACGGCTTCGTAACCTTGTCGTTCG
TAGCTATCAACAACTTGTTCAGTTTGATCGACAAACTCCTGTTCCGATAGTTGGTGATCTACTTTTTCATCACGTTCGTATGCATTTCCTTGAGTGTCGA
CTGCAACTACAGTGCAGTTCTCGTCATAATAAGCTCCAGCTTCGTAACTTTCTATCGTGGGATGGAACTCTTCGCTCAATCCGTGATCTTCAATATATAG
ATGGTTCACTTGGGCCTCGTGGCCAATCGCTGCACTTGCACATTCATCAACAGCATCCGATGACTCTGGTTGAATCGAGTCTTGATCGAAAGACTGCTCT
TGTGCGTCAACCAGTGAGTTCCCTTGGCCTTCATCAAGTAAACTAACTTGATCTTTAGTCGATGGCTCTACAGGAATTGCAGCTTCAATATCGTTGGGGT
TTGAATCATTAGCTGAAAGAAAACCATCGGGGATAGCGCTGTCGACTTCTTCTACATCAGTAGCTGATAAATGAGACTGGTCTTCCGATAAAGTAAATGC
CTCACCATCTTCATCTATTGCATGGTTTTCAATGGCAGTCTCGGGATTCATTTCGGATGATACCTCGTTCGTATTGTGAATTTCAGCATTCTCAAGATCT
ACAGTGTTCTCAGCCGAGACGGCGAGTGCTGACTCGAGGGCGCTTCGGCCGTCTGGAACGTTAGTTTGTGCGCTCTCGACATCTAAAGTTTCATGAGAGT
AATGAGGGTTCCTTTCATCAACGTTAGCTTTTGCTTCGTCGACTGAACTTCCAGTGTTCATAGTTCCATCTACACCTTGATCGGCAAAGCCGGCATCGAC
TTCAGCGTTA