Description :
From Genome Similarity Track
Location :
Scaffold_13:82385- 85124
Transcript NameFunction/comments
Physo_130829putative polyprotein

Sequence
2739 bases(100 bases per row)
TGGCTCGGGTCGCGGTAACGCTTGAGCAAGCCCACGTAAAACACTGGGTGTGTGCGCATCTTCTTGGGAAGGTTAAGCGTGTACGCAAGGCCCTTCTTGG
CCACGACCTTAAACGGTCCGATGAAGCGAGGACGCAGCTTAGTCTTGAAGACCGCAGAAACTGCATGTGTAGGTAGGTTTTTCGCGTTTAATAACACCAG
GTCTCCGACCTCAAAGTTTTCCATATTACCCCGGCCTCTAGCGTCAGCTTGTTCCTTTTGAACGTCTTGGCTATCAGCCATTGCGTCTCGCACATGCCTT
AAGACATTCAGACGGATCGACAAGAAGTCGTCCAGTTCCTTACAAATATCACGAGAGCTGACATCAGCAAGCCTATCGGCTAACTCTCCCCTACCAAGCC
CAGAGTCACTACGTGACGGCGTCAACGGGACGCGAGGGTGAGTAAGCCCGTTCACGTAGAACGGAGTGAAGCCTGTCGAGGCATGCACCGCATTGTTCAA
CGCGAACTCAACGAGAGGGGGCATCGCGCTCCAGCGCTTAGGCGTCTCCGCACAGACACTGCGAAGAACGTCTTCGACGACGCGGTTCGCGCGCTCAGTT
TGACCATCGGTCTGGGGGTGATCCGCCGTGGACATATCCAAACGAGTGCCAAGCACCTGAAAGACGGACGTCCAGAACTTCCCCGTGAAACGAGGATCTC
GATCCGAGACAATAGACTCAGGCAGCCCATGCTGCCGAAATACGCGGTCGATAAACAGCTCCGCTGTACCAGACCCGTCAATGGTGTCCGGCACTGCCGC
CAGATGAACCATCTTACTGAGACGGTCAATAAAGACCACAACTCCCGTGTTGCCTGCCGAATCCTTCGGTAAGCCAAACACAAAGTCCAGGCTCATGGAC
TGCCAACACCGGGACGGGACAGGCAAACTTGCCAACGGCGCCGCCGAATGTGGGGAGGGTTTCACCCGTTGACACGACTCACAGGTACTCACGTACGTCT
TAACCCACTTGTACAGCTTGGGCCACCAGTAGTGGCGGCTCACAGAGCTGTAGGTCTTTTCGCGACCAAGGTGGCCGCTCAAGGGAGAGTCATGAGCCTC
ATAGAGGATACGATACTTAAGGTCCTCGTCGTGAGGAACGACGACGCGGGGCGTGTCATCCGATCCAGTGCTGTAATACAGCAGATCCCCATCCAGGGAG
TAGCGATGTAATCGCGCCCGCAACCGCGCAGACAACTTGAGATCCGAGTCTCGAAACTCCGCGCTCCCCAGCGTCCGTAGCAAAGCTACACAACTCTCAT
CACGTGCATACGCGACACGGATCATGTCAGTAATCGACGAAGTCACACTCGTGACGTGAGCGAGCTCGTAATCAGACCTGCGTGACAACGCGTCGGCCAG
CGCATTCTGCCGACCGGGCTTATACGTCACCTCGAAGTTGTACTCCGCAAAGAACGAGAGCCAACGGGCCATCCTCTGCGAGAGGTGAGGCGACTGTGTC
GCAGTGCGTAAGGACGCGTGGTCTGTGAAGATCACAAACGGCTTGGAACCGAGCAGATGGACCCTGAACTTGACGAGGGCATACTTCATCGCGAGTAGCT
CCTTGTCATGGACAGGATAGTTCTTCTCAGCAGCCTTTAGCTGCCGAGACTCGAACGCAATGACCCGCTCACGCCCATCGGCGTCTGCTTGAAGCAGTGC
ACAGCCAATGGCAAAATCGGACGCGTCACACACGACGCTGAACGGCCGATCGGGGTCTGGCAGTGCCAGTATCGGTGCCTGAAGCAGGTTTTCCTTGACT
GCTTCAAAAGCTCTTTGCTGCTCGGCATCCCAACACCATTCAGCATCCTTCTTGAGAAGGTTAGACAATGGCTGTGCCAACTCAGCATAATTCTCGCTAT
CTTGTGCAAATAGTTTGCCAGACCCAGCCACTTGCGCAGGTCTTTCGGGTTCGCAGGAACCGGCCAGTCCACAATGGCCTTGACCTTGGCAGGGTCCGCT
CGGAGACCACGCTTCCCAATGAAGCATCCCAGACAGGGAATTTCTTCAGCACCGAAGATGCACTTGTCGGCATTGGCGTAGAGCTTGTTCGCTCGCATAC
ACTCGAGCACGGCTCTCAAATGGTCGATGTGGTTCTCCATATCCGACTTCCCGTGCTCCGCATGACTGTGGACGAAGATGTCGTCAAAGTACGTCTGCGC
ATATGCGCGATGCGGCCGAAACAACTGCGTCACAAGACGATTAAACGTTGCCGGTGCGTTTGACAGCCCTTGGGGCATAACCACCACTCCCAGAGCATAC
CGCTCGGAGTACTCACCGCAGTGAGAGGGATATCACTCGCTCTCATGAGCAGCTGATAGTAGCCATCGACCAAGTCGAGAGCGCTGTACAACGTGCACCC
AACCATGTTGTTCTGAAGAACATCCTTGCGAGGTATCGGCGTTTGTGCCGGGATAGTGGCCACGTTAAGCTTGTTGAAAGCATGCACAATGCGCCACTTG
CCGTTCGGCTTCCTGACACAGATTGTCGGCGTCGAGTGCGGGGACTTGCTTTCGCGCACCAGTCCTGCCTCGTTCTTGGCACGAAAGAAGGCGTCAATGA
CGTCACACTGTTCCTTGGGAAGTGGCCACTGGCGTGTGACGCAATATTTGGTTCCCGGAACCAAGTCAATTTCATGACGAACGCCTTGATCAGGAGGTAG
GCCCATAGGCGGGTCCTTCGAGACAACGTCTCCGAACTC