Description :
From Genome Similarity Track
Location :
Scaffold_8:82373- 83812
Sequence
1439 bases(100 bases per row)
CACCGATCACGGGGCGAGATCGACTGCAAAGCACCTAAGCTGACATTGTTAAAGCAGAAGGTGCTGGACCAACTACGGAACTGGCCAGATCACGAGCTGT
TACATGTGAAACGAGACTGGAACGGAAGTGCGGACAGCCTTGCCAGTGCAGCACTCCAACGTGAAGGGGGCATCGTCGTCGAGGATGAGGTCGATCCTGG
GGATCTAGTGACACTGAACCGACTTAATGAGATCCTGGTTGTTCGATCGGATGGGTCGATCGCCCGACTATCGCCGATGACCACTCGATCGGGCGACAGA
TCACGGCAGAACCCGACTGTCATGCAGGAGGAGTTCGTGCGAGGGTTGCGGATCGATCGAATTCGTCGAGCTCAAGATGAAGAAACGTGGATCGCGGGTA
TGAAGAGGTACCTGATGGGAGATGTGGCTGATCTGACGCAGAATGAGGCTCGATCCTATGGCAACATCGCAGCGGATTACGAGATCGACGGTGATAATCT
GCTGTTCTATTGCCCACCCTCCAAGCGATCGGAGGCAGATCGAGATGGACCGATGAGACTGGTTGCACCGGAGACGCTGCATCAAGATATCTTGCATCAC
TATCACTCCACTTTGGGAGGGGACACCAGGGGATCGGGCGTACCTATCAGCGGAACCGCGATCACTTTCACTGGAGAGGTCTCTTCAGGAGTGTGCGGAA
GTACGTCGGTGAATGTGTCGACTGCGAGACCGGCAAAGGACGACCTACGATCAGGGGCGAGTCGCCGGGGAACATCCAGGCGACGTACCCGTTCCAGATC
ATAGCGATGGATCACATACCTTCGCTGCCGAAGTCGTACAAGGGTAATACGGAACTGTTGATCTGGGTCGATCTGTTCACGGGATACGAGATCGCGAAGG
CCAGTTCCTTCCGAACGGCGCAGACGATCGCTGAACCTTACGAAGAGTGTGTGTTCCGGTGATTTGGTGCTAGCGAGGTGATCAGGCACGATCGAGAGCC
GGAATTTATGGTCGACTTCTTCCGCGCCTTTAACAAGATCCTGGGTATGCGTCAGCGAGCGACGATGCCATATCGACCTCAAGCTAACGGTACTGCAGAG
CGAATGGTACAGACGGCGACGAGAGCCCTGAAGATGTTCGTGGAGGATCTGGATCAGAGAGATTGGGATGAGTACGCAGAGCGATTGACCTTCGCGATCA
ACACGGTTCAAGATCAAGTCCGTGGAGACTCCCCTTTTTATCTGATGCATGGTTGGTTGGGATCCTCGATCGACGCTCGAGGCGACGATACTTTTGGGTA
GTACTCGGACTCGGGATCGGAATCCTCGACGGTGGCGTTTTCGGATCCAGAGGCACTACGATCAGGCTCGAAGTCAGGTGAATGCTCGCCTACGCAAGGT
GATCGCGGATCGGGCCGATCGACACAATGAAGAAGTTCG