Description :
From Genome Similarity Track
Location :
contig_43:82369- 83372
Transcript NameFunction/comments
g6322.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GTACTGCGGGATGACAGCGTGGCAAACAATTCCCTGCTCGGCGTTGTAGTAGTGCGTGGCCTCGAAGTTCCACCAAATTCCAGCCAACACGAACGCTTGG
ACAGGACACACGTCGGTCAGGTTTGCTGTTTCCTTTTGTAGATCGGACGGCACGACGAGAATCTCGGACATTTTGTGCGGTATGACGAACTGGAGATAAC
TTCGTATTTGGAGAGAAAGAGGCACCACGCCCATGCAAAACCACAGTGCAAGCAGCATGACCTGAGCTGTCAAGCAGCGGCTTCTGGTTGATGAAGGTAC
CCGATAGGCAGGGTGCTCCTGGATGCTCCTCTTCATTGTCAATATATCTGCAGCTGCTCGAACTAGTGAGATGAAAGGAATCCGAGTGTCTGCTCGCGTC
CGCTCAAGAAAAACCGCTTGGAAACGGACGAGATTTTCTCACGGAAGGCAGAATGATCCAACCCCTCTCTGGTTGTTGCTTACTTCGGCGTCGGGCACTG
TCCAAGATGAACGCATATTGTGAGCGGTAAGGTAGCCGCAAGCATGAAGCCTGGCAGGCATGAAGCCTAGTGGAAAGGCACTGCCACTTTTCTTCCTCTC
AAAATCCAAAAGTCAAATTGCCGATCGTAGACCTTAAGTGCTTTTTTCCAGTCGATCATCATACCTTTCACTCAACTACAGTTTGAACCGATCTCTGGAG
ATGCCAATTGCTTGGTTTTGCTGCTTTCATCTCGCATTACCCGCTGTTCGATCACGTTCTGGACGTGCTCTTAAATCTCTGATATCATCGGACAAAATCT
ACTAGCAGACTTGTCGAGACTCCTCTTTTTCAGGACAAGAACTTCATAGGTCGTGGGCGAATGGCATTATTCGGACTTGGCAAGTCCAGAGCTTTCGTCC
GACGCCTGTTTTGAGCGTTTTGTATGAAGCACCGCCTAGACTTCGATCCAGGAAGCTGGTTATACCCGTGCATGTCGCTCGGTGCAGGGCCCCACACGTG
AGT