Description :
From Genome Similarity Track
Location :
Scaffold_5:823678- 825299
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04585transmembrane protein

Sequence
1621 bases(100 bases per row)
GGTCAATCGTCCACATCACGCGCAGATGCTGCAGCTGCAAGTAGATGTGGAGATGCGAGGAGATACAGTTTTGCTTGAGTAAATTGTTATGTGTTCCGCG
AATCCTGTCAATTTTTTTTAAAAAAAAAAAAAAAAAAAAAAAAGCGCTTGCTCAACTCGAAGTTTTTTTTAGTGTAGCTTTAAATTATGAATACATTTAT
ATAAAGAAGGAAATAAATACATTTGGAATTGACATAGGACTAATGGTTGGGTAGTGATTACATGTCCATTCCATCGCGAATATTGGCGTGCATGTGCTGT
GTTGAGTTTATCCCTGTATATTTTTACAGGCCGAAATATGTCAAATGCTGATGGTGTCAGTATCTTTGCCAGAAGTTTGCAATAGAAATGGCGATTTTTT
CTAAAAATGAGAATTAGTTTATGACTCTAGATATTACCTTTGTAGACCGGCGAGCTACGGAAGAACTCAATTTCGTGTTCCCCTAGCTACGAGAAGGGAC
TAATAAAGGATTCTTTAAACCTTATTAAAAGTAAAATCCAGATTTGTTCCGGGTACCATTACTTCCTTCCATCTGTTAGATTATGGAGTTTTCAGTGACT
TCAATGCATAGCCCGAATCTATCACCGAGTGATCAAGCAACCGGCGTGGCCTCCGAAATCCAGTAGTTTTCTTCAGTTGCCGTATACCACGTACATGACA
GCGCATGAGTAAGTGTTCCGTGCTCTGGGTGCATCCACCAGCGCAGTAGAAGGATGTTGAAAGTGCGTAGGAATTTTGGTGGGAACAGTCGAGCCAGTAG
CAGGAGCACCACAGACGGAGCCTGGTACACATGCTTGCCGTAAAACAAGTAACCCGTAAGTAGAAGTGCCTCCACACTCGTACATCGCTTGTTCATGAAC
GTTACGTAAGCGAAATCGTCGCAGTCCATGAAAAGCTTGCTAAACTCGGAGCCTAGGCAGAATTCCTCGAATGTCGTACGAGTTGTTGTGATTTGGTGAT
CTACGGGCCCCACTCGCTTGTGTTTCCCTAGGAGAACAAAGCGAGCACGCGGTATGATCGCAATGTGAGGCGTCTGACCTTGGGATACTCTCTCTAACGC
AGTCTTGGGTTTATTAAACCTCTTTACGGGACTTTCGAGTTTGATGAAAGATAAGGTTTGACTGAAATGTGTCCACGGACTGCTGTGCTTTTGCACCATG
TATGAAGCTGACAAGGCGATGAGTCCCAGTAAAGTCGAGCCAATTACAGCCATGATTGCTAGATTAAGCTGCATGACGATACAGGAATCGTGTAAACCGC
AGTATTTGGCTCCTTCTATTGTGGTTTTACGGAGTAATTTACCGTTATAGTCGACAATCCACGGTAACGACGTCAGATACGAGGAATACAATACGCAAGC
CACTCCAGTCGTAATGACCACTTGCATGATCTCCCATGTAAGTCGGAAGTGTCGATCGAGTTTCTGTACTCCGGATCGAGCTTTTAGCAGGTTAATGAAT
GCATACGAGAAGGCAAAAAAGCTGAACGTGAGATTCGCTAAAGACTCCACTGTAAGGGTACCCGTAACGAGCCCTAAATAATACGTATCCGAGTTACGGG
CCAAATGATACGTAACTTGCC