Description :
From Genome Similarity Track
Location :
Scaffold_7:823674- 847822
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05276hypothetical protein
Phypa_INRA-310PPTG_05277hypothetical protein
Phypa_INRA-310PPTG_05278Ca2:Cation Antiporter (CaCA) family
Phypa_INRA-310PPTG_05279hypothetical protein
Phypa_INRA-310PPTG_05280hypothetical protein
Phypa_INRA-310PPTG_05281hypothetical protein
Phypa_INRA-310PPTG_05282hypothetical protein
Phypa_INRA-310PPTG_05283hypothetical protein
Phypa_INRA-310PPTG_05284hypothetical protein
Phypa_INRA-310PPTG_05285integrator complex subunit
Phypa_INRA-310PPTG_05286hypothetical protein

Sequence
24148 bases(100 bases per row)
AGAGTCATCATGAGATGTCAGCGGGTGTTCAAGCTGGTAACGGAGAGCATTGACTGCCATTCTTGTGTTCATAGCCGGAAGGTCCTACCCGTTAAAGGTT
AGAATGCCGATTTACAGATACGAATGCGTATATCTTACTTTTGAATCTACAGCCAGCGACCGCGTGATCATACAAGCTGGAACTGCAGGAAGCTGATCGT
GTACATTAGCAAAACCAAATGAATCCATTTATACGGTAGATGGTCTTACTTCATTTGACGACCCAGCACCCGCAAGAACATCTTCAATGCCCACACCCGT
CAGAAAGGTAGTGTCATTGGGATTATACTTCAATTCTGCAGTAGATGCGAAAACAAATCAGTTAGACCTGTCAGCAACGATGTGAAGCTAGATTCTTCAT
CTTGGTACTAGTACGTACGCCTCCTCATAGGTGTTGATGGAGTATCGGACTATCATCAATATATGAAAGTACTGTTTGTCAAAAGTAAGTCCAACAACAA
TAAGCTAAGCCACGCACCTGTCGTTTTGATAGGAGTTCTTTATCCGTGACAGTGTCTGGATTGACTGTCGGCATGAACTCGGTTGTTCGTGTGTGGAATG
GAGATTGGAGAACCACCTCGTTCGGAATCATTTTATAAATCTCGACGTGTTCGTAACAGGACATGGAGTGCAGCTTCTTCTTCTTTGTGGCGGGGTACGC
CACCATAATAGTCATTGTAATTTGATCCGCTGTTCTTTCATTCAATATTGCTGTCAAACTCGGTACAGGATCGTACGCCAGCTTGGTTGGGTCGTATGAG
GTGACCGCGGCGTGAGCCAGAGGATTGCCATAGAGTATGAGCTTTCGCAAGCTTCGTAGCTCAGTAGTGTGTACAACAGCTTCTTCCTCGGTAATCATGT
TGTGCGCGAGATTGAGGTAGATGAGATTGTAGAACCCAGCACCACGCTTTTCTTCTAAAGTCAACGCAGACTATCATAGGCAATGAATACACCGTCACCA
ATTATTAATCTCCTGGACAACGTACCTCAGGAAAACCAGTAATCTTGTTGTAACTCAGGTTTAGATTCCGTAGGCGAGGCATGATGGCGATAAAGGAAAA
AACTTCCTGTCCAGAAATATTGTTGCTTTCCAGAGATAATGTCTCGAGTCGAGAAAAGCGATCCATAATCGGTGGTAATGATCGAATTCGATTGCTACCA
AGATATAGCTCGCGAATACGCAACAGATTCGAGAGCTCCTCAAGGTCTTTCGATCCTAAACAGTTGAAGGATAAATTCAGAACCTACGAAAAACAAGTTA
ATGAGTGCCGACAACATAATTTCTTAAGCAAGTTCAATGTGGTTCGTACCTCAAGACTCTGGAAACCATTGTTGAGCATGACCTCTTCTAACGCGTTACA
CTGGAAGTCCAACTCGACGAGCGCTGGCAGGCACCCAAACGGTTCTAATGGGGCCTACATTTTTTCAGTATAAAACGACAAATTGACAATCAGCTTTGCA
TATTCACGCTTTGAGCCTTTCAAAATAATATCTCAAACCTCGTTGTCACTCATATCTAACCGTGTCAAGTTAGTGAAAAAGAGTAGGTCCTCAGCCACAA
CGTCTGTAATGTGCATGTCGCTCAAAACTGCCTGGACGACTTCGTCAGGAAACTCCACTACAAGGAACAAACGAATTCTAACAACAATGACGTAAATCTG
ATAAAGAGTTGGCGGTTTGCAACCAACCTCGACACCAGTCTAAGAGCAGAAAGCCATCCAGTGTTCGTGGCGAATCGTTAGATATTGCCCGCTTCCTCGT
TGATGTTCGTGAGTACTGGTTGCTACTTCCTGATGGAGATAACAACTCAGCAGGAACATAGCCTCGTGCTACAGTCTGTCCCGATTGCACCAACGTCGTA
TTTGCCGCTGGCTTTTTCAACACCTTGTCGATCTTCCGACGTCCCGTAGAGTTGGAAAGTGGAACAGGAAGCCGACTATCGTCACCACGCTCCGTCGGGG
ATATCATCTAGCAACCAAAAAGCTCGCCAAGCAGCTAACTGCCAGGAGAGTAGACGGTCTCGAATGGCGGTTTTCAATACTCCACCTAAAATTGCAGTTT
CACGTTACCTCGATAAAATGTAAAATGCCCTATCATGTTCGCAGCATGCATAATAAAAAAAAGCAATTCACCTTGTTCTTTAGTTACACGCAAAAATGTT
TTGGTATAAAGGGTGATCGGTGTCTCCTAAGACCCATCTCTTTTGTGTGTTTTATGTAAACTTGGAAATGACTCTCCAGATAATCACAACAATGAGGCCC
AGGATGACCAGGTACAGGAACAGAATCTGCGACGCCATCTTGCACTTGAGCTTCTTCAGATGCATACCCGCTTCTGCTGTGTCTTCACGCGTCTCATCAA
CCTACATACATCCACAATAATCAGCTTCTCTTTCTTACTTATCCACCATTTACACAAACGTACGTTCGAGCGGACGTTGATAAGCTGCTCGCGTTGATCC
GCCAAGTTCCGATTAATGTTCTGTGCCGTGGCCTCGGTACGCGCGATGATGGCCTGGGCATCATCCAGGTGGTCGTCGATGCGGTCCGTGCGCTGCTGGT
AGCGAGCCACGTTGTCTTGTGGGGCGGCGGCTTGGCGACGCTGCTGACTGCCGTCCATGAGCTTGGAGCGCTCAAGATTGGCCTTCAGCTTGTCCAATTG
CGACTTAAAGGTGCGCAGCTGCTGGTGCATCCGTCGACGGTCCTGCGAGTCTCCAGCGCGCGACTCGCTTTCGAGGATGCGCATATAGCGCTCGGCCTCC
GAGATGTTGCCCTGTGCACGCTCTGACAGGTCGTCACGCTCGCGCTGGTCACGAGCCTTGGGGATGGAACGGATGTCCGCCATCGCGTCATCGCGGCACT
GCTCAAAGTCCTCGCTGTAGCCCATAAAAGCCTCCGTCATGGTCACTTGTCTGCTAGGAAGGCTAGTTCTCTGTTTGTAAAGGCCCTTGCGAACGTTCAC
GCCCTGTGTCCGATACAAAAAGAAAGTCAGACACAACCCGACAATCCAGGAACAAACAAGGGATCTGCGACAAAACACACCATGTTTACACAAATTTGTG
CCTCTCCCAGTGGCACATTGTACCAACTTGGCAGCTGGGCAAATGTAGCCATGTAGCCACCGAAAAAGTATCCAAATGTACTCGAAGAAAAGTTGAAACT
AATGGTGATCATTACTATGCGCTTGTTATCAAGCTCACTACCACCTCGGAAGCTGCACAACACAATTTGATCATTCAGCTACGTCCGTCACAGCTGAATA
CCTGGCCAAAAACACAATTTAGTCGAGGCCAAGCACGTTCTCCAGCAGGAACACAAGGAAGATGGAGGTCGGGTACAGCAGCAGCACAATCAGACCGTCG
ATCAGACGCTGGGTCTTCTTCATGGCGATGTAGCCGATTACAAACTCCACAAACAGGATCGAGAAGGTCTCGGCGGAGAACTCCCACACCAGGCCACCGC
TCTTGAACGACATAAGCGCCGCGAAGATACCCAGACAGAAGGTGTTGTTCATGCATGCAGCACCCAGAAGAGCAGCCACCGAGATGGAGATCGTCTTGGA
CGTCTTCTTCTGCGCGTAGTTGTAGGCAGCGATGAGCTCACTGGCGTTCGAAGCCAGCGGAGCCACCACGAACGACACGTAGAACGCCGGAATGCCCGTG
CGAGCGCCAACCTCAGACAGCACGTCAACCATCGGGTCCGAGAACAGCAGCACAAGAGCCGTGCCCAGGAACATCATGTACGCCGAACGGATCTTGATCT
TCTTCTGTTGCTCAGCAATGGACAGATGAGCGAGGTCTTCAGGGACTTCCTCTTCTTCCTCTTCATCGTCCTCAGCAGGAGGGATAGCCAGTGAGTACTG
CTGCTCGACCACCACACGCTTCATCGAGACGGACGAGCGGCCTTGCATCTCGTTCTCGTACTTAGCCAACAGGTAGCGTAGCGTGGCCTCCACCAGCTCG
TTGAACTCGATGAATCCGCTCTTGTCCTTGTCGGCCGCAGCCATCCACCTCTCTGCCTCTTCACGCGAGACATTCTCACCCAAGTCCTTGAAAAACAACT
GCAACTCATCGGCATCCATGCGGTGGTCACGGTTCTTGTCGTATGCATGGAAGAATGGACGGATGACGTCCGCAACGCGGTCGAACTGTTCGCGAGTGGC
GTTGAGAGGCGTCGTGCTGGTGGGCGACTCCATCTTCAGGTGGGCCACTTCTTTAGCCAAGATACCGGACAGACTGATCTCACCTTCACGGATTGCAGCG
ACACGGACCTCGTCAATGACGTCCTCTTTGACCTCCGAGGAGCGCTGCACGTTCCAGTAGAGGTAGAGAACAAAGGAGATCATAGAGATGACAAAAGCTA
CGATAGCGAAGGGCTTCTCGGCCTTGGCCACCTGGGCGTTGTCAGCCTTGGCATCCTCTGCAGCGGTGCCAGTGTAGAATAGAGCAGGCACTTGTAGGAT
GAGGTAGATTAAGCTCGTGAGGATCATGGTTCTGGCCGTGGACGGGATCTCGTCGAAGAGCACGACGCCAGTCTTGGTCAGGTTCCTGTTTCCAGGCGGC
ATGAGCTTAGCCCAGTGCTGGTCGCCCTTGGGACGCACGTAGTTGCCACGGCCGTTCTCGTCGATGTTGACGCGGCCGGCGTAGACACTGAGCGCCCATG
GGATAGTGAGTAGCATGATGGTGGAGCCGGCGAGTGCACCGACGCCCACGGAGACCTGCTCTTGGGCGTTTGGGCCCATACCAGAGAAGAGCACGATAGC
ACCGTCGGGCACGGCGCCCAGTACGGGCAACACGACGCTGCCAACGATGCCGGCCATGGATGGAACGAGCAGCAGCAGCTCACTGCCGTCCGAGATGAGG
TTGCTCGCGTTGAAGAGCACGAAGCCGTAGACGGCGCCCAGGAAGAGCACCTGGATGAGGCCGTAGCCACCGTCCGGGAGGTCTTTGGGGTCAATGAAGA
AGCCTGACATGGCTGATCTCAGTCCTTGGTTCTTGCTCTGAAGCTTGTCACGTCCGCGTGCTTTTGCCAAGTGAGACTGAGCACAAGGATCGCGTTTGTG
GCTCTCTTCAAGCAACCTGTTTTTTTTCACCTCAATACAAATGACAAGTACACTACTTTGAATGGACAACTTACGTTGGATACCCCGTTTTTACCGATTG
CTCGAAATCAGTTTCGACTAAGGGAGGCGTATCCTGAATCTTGAAGTGCTCCTCGTCTAGGATAATTTATCCGCCAAGCATCTTGTAAATCTTTTCCAGG
CGATGAGCTGTTGCATGGAGGCAAAGCCGTCCTTTTCGTAAAGCATTCATGCAGATTCGATGGGTTAGTTGGCACTTGTCGGCAACGTTCGCTCCTCCGA
CGGCCAACTGGACGTGTCAATGATGACTGGGCGGGAAATCTGCTTGTTTTCGGGGCAGCAGTGGATTTTTCATGCATCCTTCAGCCGCTTTGCTTATCAA
AGTTTGATGGGCAACGCACTCGCAGCCACGATCGGTGGACTTCACGTTGGCTTTGTCGTGATCACACGCACGCTACGACTGCGAAACGGAAGACCGCGGG
CATTGAGCAGTCCGTGGTCCGGTTCGCTGTTTCATGCAATGGCATCAAATGTGCTCGGTTGATCTAGCCTGTGTTCAAGATCGACCAAGTTGCCGGTGAA
ATCAGTATACATTGCAATGTATACATGATTTAGAGCATTATACGAGTGTATACACCGGTCAAGCACTTGACCGTCAAGTTGACGCACGTCATTTACAATG
GAGTCCAGCGCCGAGAAGTTATCTGCTACCTCTGGAGTTGCCACTGGCAATGACTGCCTCCTTCAGAAGCTGATTACTTCGACGTACGATGGAAGGTTGC
CTGTCTCATTCTCAGTGCCGTGTTTGCTCAGCTGCAGACCAGCACGTGATCATAATGGTCATCGGCCACTCATGATTCCTATCTAGCAGGTTCTTCGAAC
TACTCATTAATGGTTTGTGATATCGTTGCATGGGTGGTTCCTACGCCACGTACTCTCTAACTCTCGCAGTAGATACAGTCTACGTTGTTCAGATCGGTTG
TAGTCGAAGATATTTGCAAGAGGGCACTCTCGATCATCAAGATGTTTCTAAGCCCACAGCAACAGCAAGACCGCATCTAACAATGGGAATGCATCAACCG
TTTTTCACAGCAATTTTGTTCATACGCAGGCGCAGCAGCACTGTACCAGAAGCCTAAAACTCCAGCACTAGAAGCCAGTCATTGTCGATGCTACCGGTCG
TCGGTGGGGTGAAGTCCACTCGGGTATCATTGCCACCCTCCGGAACGCTCACAGTAAAGCTCGCGTAATACTGACCATCGCGTGGTGAGAACCACGTCGC
GCTGCCCGAACGACTTCCCGATCCATTGTCTAGCTGCAGACTGAACGAGTCACCGTGGCCAGTATACACGAAGTAGTGGTCCCGTGCCTTTGAAGTTAGA
ATCGAGATGTACCTGGTGCCCTCAAACGTGTTGACCGACTTACCGGTGTGGTTGCTAGGACTGGCGAGGATTTCACGTGCTGGTTCTAGCTGCTCCAGGT
TTGCGGTGGAGAGGTTGCGGAGAAGCTTCGTGACGTACTGAGCTTGCATGCCACCTTCAAAGTAAATGTCCTCGCGCCACGATCCCGATTCATTCTGGTT
AAGTAAAGGATTGTAAAAGAGACTCTCTTCCAGCAGGTTTGATTTCGGTTCGTACAGTTGCCACACGCTCTGAGCACCGTATGCGAATCCCGTGGCACCA
TTGTAAACCGCGTGGGACAGCCCAGTGCGGATATGAGAAGCATTCCGCATCGGTTTCTCTGCGTTAAAGTTAATGTGAGCTCCCTCGTAGTGGTTCTCCA
AATCGAGTACAGGACCAGTGAACTTGTCACGCATCTCGACGATATTCTCGTAGTTCTTTGTGGAGTCCCAGCCGCCTATCGGAGTGAATACGTCGGATCT
AGTAGAGCGTGACCAGTCAACCGATACGCGATCTTCCTCGTTTGGTAGCATAGCGTGGCCGTACGGCAGTGGCGTCACCTCGGGTTTGACGATCCAGCTA
TTCGTGGGGTGAAATAGGATCATTGAATCGTAACCAAGGTCGCGCTCGGCTTCCTTGAGACCAGCACGCATAGCCGACCACACTGCTGTCGTGTCCTCAA
TGGGGGTCATCATGCTGGTAAAGTCCTGGTCTGGGTTCTCGTTGTATGCCGCCTGAACCAACGACATGTTCCACGACCAAAGCACATTCGAGTCACCGCC
TAGAACCTTTGGCAGACCAGGGTAACGGGACCCAATGAACTTGCCATAGTCGTAGGCATTGACTCGTTAAAGATGGGCACTTTGCTGTCCATTGACGTAC
ATGCCCCAGGTCGGCACAAGAGCGATGAGAATGCCGTAGCTAGCAGCCAAATCCACAGTCCAGTCCACCAATTCAAAGAAAGTCTCATTTGGAGTAGCTG
GGTTTTCGTTCGTAAATGGCATCTCGTTGTAAAAGTTAGTGCGTGCCGTGCCATTCACACAGCCGGTAACAGCGACTTGGATGACATTGTAGCCTTGTTC
AGCACGGGTCTTGAGGTAAAAGTCGATCGACGTCTTGCTCAGTCGGTGAAAGAGCTCCCACGCCATGTCAGCCTGCCAGAAGAAAGGCTCCTCAGATGCA
GTGCGATAGGCCTTGATGAGTTTTGTTGAGGAGAAGCAAATTGCAGCATGATAAAAACTTGGTGCTTGGTGCTTGGTGCCTTAACGTCCAGTGTCTGATA
GGCAGACACCAGCTACGGTTTGTGAAAACGTGGCCAACCAGTCTGAAGAATAAAACACACGCCGTGATCGCCGTGATCTCAAGGGCAATGAATCCCACGT
CCGCAGAAGATTTACAGAAGTATTGCGGGCCTTGTTCCTCCTTTTGACCTCTTTTTCACCAGTATCAAGCTTTTCGTCCATTATTCGTTATTATGGCTCG
CAAACATCATAACGCAATCCTGATGCTTCAACTTGAAGACCTTCCAGTTTCTGAAATGCTTAAAGAGCAAGCATAGTCATAGCCACATTGGATTTATCTT
CTCCAATACCAGCCTTTTCAACGATAGTATTATAAATCCAATACTCGGCAAGAGTGGGTTTGTTGATGCTTTTTTTCAACCAGTCATTCAAAGACCAAAC
TTCATGCAGCCGCTCTCCTTATGCTGATCTCCACAGCTCACACTGCAGTACCTGGATCCACACCGTCGACAGTTGTAGTTGGCAAAGAACCCACATACGC
AGCAAAATCTCCGTGCCGGGTGTGTTGAAGGGCCTGCCGCCGCCGCCAAGTAGTTTGGTCCCTCAGCGTTGTCTCCATTACCCAGTTCCTCGAACACCAA
TTGGGCCAAACTCTTGACCTTCCATTTCTTCTTGCCCGGGACGACAACCCTCCTCTTCTTCCTGATGACTTCCCTACCAGATGCACTAGCAACAGTTCCT
CCTTCCTCCTCATCCACATACGCTTCGTCTCCATCTTGTGTTCCATCGCCATCATCCGCGTCTTCACCGAAATTATCAGCTTCCAATGCGTCCAACCGGG
CGTTGCGCACCTCATTTCGTGTGTCATCATCCACAAGTCTCATTGCTGCGCTTAGTTTGTGCGTGCGGCCTGTATTTCCCATACAAAAATGCATTATCAA
TGACAATTATCAAGATACTACTCTCGCTCGCGCCGTCTCTAGTGAGTGCTAGAAGCCTCAAGCAGCGATAACAAAGCCTGTTCCTACCTGAAAGGCGCTT
CTTCGCAGCGGTATGCCGTCCGCCGGCAGCAGAAGTCTTCGCCGTCGTCGCCAGGATGGTCTCATTCCACCGCTTCTTGCCGTCATACGCTTTGCCCATT
TCCACTTTCAAAAACCTATTTCTTTTTGCAAAATGAACAGCCTTACAAATTTCAAGATAAAATTTGTCATCAATTTTTGGCTCTATTGGACGACACTAAC
TTCACTACCATGAAACCAACGTTTGGCGTTGGCATTTTTTCTTCTTGCAAATTCCTCACGTTTGTCTTTCATCTCACTTTTCACGACGAGATGGAGATAG
CTCCGCCCATTGGCCGTTGCTCGTCAACTGTGCTGGATCGACCAGTTGCAACCGAAGACATGGACCCTCGGCCGATACTCTCCGTCTTGAATTCAGAATC
ATCGACCAGACTGTCCAGTCCGTGTGTGCTGTTCTCTAAATCACTGGAAAGTTTGTCAAAAAACGAGAACGAGCTCTTCCGGAAGTGTTTGCCACTTCGG
TTGCTGGTGTGGTCACCGAACCGAGACGAGTCGCTGGAACTCTCGCTCATACGAGCAGGACTGCGCGGAATGCTGCCAGCAATACTGCTAGCGTCGCTTG
CCTTCCGATGCATGTACTGTAGAACATTCGCACGCTCTCGCATCGCTTGAGAGCAGTCGCGTTTCAAGTTCCGCGGACGCATTTGAACGCTCATCTCATC
AGCAGGAACTGACAGGATGCGGCGGATCTGAGGCGCGGCACACGAACCTGGCGCTTCGGCTGCAAAGTCCATTGAGCTCGATCGGCAGTGAACCGGAGAA
AACATCAGCTCATGCACCAGTGGCTTCTCCAGCTGTGCCAGTGTTGGACTCAATCCTTCCTCTTCTTGCTTTGCAATCTTCTCGTCGAGCGAATGATTTG
AGTTTGTTTCATCTGGGATTTCTTCCTGCGGATCCAGAGTGAAAGAGGCTGTGTTGACATACGAGTTGGTGCTTCTTGACAATGTGCTCTGGTCGCTGAA
CCCTCGAGAAGCGCGTCCATTGCTACTGCGACCGAGTTTGCGTACTTCATCGATATCTGGCTTTTGCGGGACTTCATCGATGTCGCGTTTGAACGGATGT
TGCGGAAGCATCGGACCTGGTTCAGTCTCACGGCACGTCTTCTCACTTGCGTTCTTACGCAAACTACGTCCCGCAATACCCGCGGGGGACCGAAATGGGT
CTGAATACGAGCGCGAGAGCGACGGTTCTTCCAGCATTGGGATGTTCTCCTGGTACTCGTTGGATCTCCTTCGGTGGCCTAATGAAAAGCCTTCAATATC
TAGCGATTTCTTCGGCTGGGGGCAAAGTGGCACCGGGGAAGAGTCAATGGCTCCGCGTATCCAGGGGTCCGGTTGCCCATTTCTCGAGCCCGGGAACAAG
CTTTCAGAACGCTGGTTGCGACGTAGTCTCTTCTCCGCTTTCTTCTTTTCTTTTTGGGTTTTCATGTCCTTGTGCCATTCCTCAAAGCGCTGAATCCACG
CTAACGGTGAGCGTCCTATCAACTGGGCATCCTCGTCATCTTTTATCGGTCGACCGTTGGGGGTGCTGTTTGCGCTGTTGCTCTGGATCTTCTTTGGGTG
CATGAAGCTCTTGCTGCGACGATCTCGTGTCAGTTCAGGTCTACGGTCATTGGATCCGTTCGGACTCCTCTGGTGGCTTCCCAAACTATTGGTATCTCCT
TTCGTGTGACGGCTTTCATCCTCCTTGGTTCTGCTGACGGCAAAACCATCAGTAGAAATTCGACGGACATTTCGTGCGCCCCACTGGCGATAACTGTCTG
CTGATCCCCAATACATTTCCTTAATCTGCAAAGATCATTGATATCGGTTAGAGTGAGTTTCTCATTGGTCGGTGCCACCAACTAGCGCAACACGCACCTG
GGGCCGCATTCCTTCGTAATACTGCGCAAAGTTGGGATGATCTCGCTGTAAAGACTCCATGTACTCCTCGGAGAGATTTCGGTCGAATGTTCTACAGACA
CACACACACAAAACATGTTAGCATATTTTAATTTTGAATATCGAAGTTCCTGATCACATTTGCATACCGTGCTAAGCGAGGAGGAATCTTGTCAATGTGT
CGGAAAATGCCTGGCTTCTTGCGACCAAATATCCTCAATCTTGGCTCTGACCTGGTCTCCGAGCTTCGTCGTCCTGCTGTTGAGCTCCGTCTATCCTCAG
CTTCAACTGTAGAGGCTACAATACCCGATGCCAGTTGAAGGCGGTGGTGAGCTCGGAAATCTTCGATTCGGCCACGAATCACACAATCCTGATTCTTTGA
AACCTGCATCAATGTCAAAGCATCGAGTTCACCTCTACCAAGCTGCGCATAGCATACATCATTCCAAATCAACGTCAGTGATGCATAATAGTGAGATTCA
GACCGTTGTCGACGCACCTCATTCAGGTGCTTCAGCATATCTCCATAGTTTTTACACGCGAGAAGATCTGCCTTTGCCTGTTGAAGCAAAGCCAACGCTA
CCCTAAAGAGAACCTACAAACCACAAATCCCAAAAATCAATTACTACTTGAATAGGCCACATCTCCGTCAAAAGCAAATGTCTACCTCGTCTCCTTGCAG
GAAAATAGCATCCCAGATCTGGAAAGTGACTCCTCTTTCGCAAGGACTAGCGAAAAGCGTCAAAAACCACTCCGTACAAGCAAGCGAGAGCTCCATTCCA
GACCCGCCAAGCTCTGATAGATGCTCGGAAATCTCCGGGTACTGAATCCGGACAAGGTCTGCAAATACGTGTTGGTCCACAGCCAGCCCCAGCTACAACA
AACAAACACAACACCTCAAATGTTAGCACACAAGTAAGCCCATCATTCTTTGCTAAATGCATTGAACCACTCACCATTGTCGTGTAATAATCGTCCGGGA
CAAGCTGAATGATAGCAACGAGCAAGTAGAACGCTTCTTCTTCGTCCAGAAATTGCAGACTTCGAGCCACAATATAATTCAAACCCTGGCAATACCCCAG
ACCTGGATTGTAGATCGAGTACGCGACTAATACCCGCCGCATCATCCTGGATTTCTCCTCGGTCCACAACTCTTTGTCCTCGTCAGCAACAGTTCGGTGT
AGATCCACATCAATCTGCCGTGTCGCCTCGGTGCTCTCTAATTCTGAGGCTAATAATCGTTCATACTGGCCCTTGTTTTTCCTCATTTCCAATTGAGCGC
CAGACGCCAGCATCCACAACTTCCCGTGTAATTCCTCGGGCACTGCTCCAAAGTCCCGATCTTCGCGCATTAATATTGCTCGAATCCGCTCTTCCGTGCG
CCAAATACCGTGCGCGAGAGGACCCAGCCCATCAGACGCAGAGGAATCACCCGCGCGATCTCGCTCCTCCTTCCGTTGTTGCTGATGCTCATACTCAAAC
AGTAGCCGCTGCCATCGCGATTGCTGCAGCATGTTAACGGCTTCAGGAGAGTCCAGATCCAAATCCTCTGCATCCAGATCATCGTCGTCGGCGAATACAC
CGTGCTCGGACATCGGAGACCAGTCCTGTAGTAGCTTTATACAATCCCACGATCATATTATGAGTCAATGATGCGAAGTTCCTTCACAAGACAACACATT
AAAGAAAACCACATACCGGTGCATTGATCATGGAGCTGCGCTCATCGATCGAGCGGCGGTTGGAGAGCGACACGGCCACCGTCTGCAATGCGAGGATATT
GCTGTACACTATACGCCACGTTAACACTGCATCTCACTCAAACCCTACAATACCACTCACCTTTCTCCATATCCTTGCATGTAAGCAGGTCTTCCGGCTG
GAAGAGATCTTGCCGCGCCACTCCAAGTACCTCACACGCTCTAACCATTATACAATATCCAAAAAGCAATAGTAGCGTTAGTACCCTCAACTTCCGCCAC
AATTACACAACTAATGGCTCCACTGATCAGACACGCACCTAATATATTCGCGCACATTGCTCCATGCGTCCATATCGTCGCCCTGAGCACGTACTGGGCT
GATCTGGCTCTTCATTCCCAACGCCTTGTACAATTTATTGATCAGATCGCAGAGAAGTACGCCCGAGTGCAGCGTCGCTGGGAGGTCGCCCACAAACTTG
TCGCCCAGCACCATCTCCATCCAGCGCCGCACGATCTCGCCGTCCTTACTTAGGTTGCGCGTGGGTGAGAGCACCACGCCCGTGGCCAGCTCGTCCTCCA
TCTCCATCCTGGGGGTTTCACCAGCCGAAACGACACCGAGAACTGGCGCTCGGGCATGCACTGCCACTGAGCGAAGGGCTGTCTGTTGTCTAGACTCTAT
CGCCTGCCGCTGCCGTCACTCACGGCGCTGCTCTGTCTGCACAAGAAGCGCCCGAACTGAATACTGAACAAGTCTGCGGTCAGATTTATGTTTGGCACAC
CAGATGAACATAAACCATACGTCTAGAATAGTGACTACCGTTATTATAACTGAAAACGTTAGGGACATTATAGTTTTGGTGGAGGTTTTATCTGACATTA
GTGACATCTTGAATAGACAAAGATAAAACGGCATCCCCATGGCCTGTCACTTGTTACCCTGTGCAATACGATTATCTCCCCGTTCAAGCCGATACTAAAG
TTGCGGGGGGTTAAGTCGTCAGCCTCACTTCCTGTCCACCCGCAACTGAAGCCGCCATGACCAGCAACAAAGACGCAGTAGCAGCTTCAACTTTACCTTC
GCCCGCGCTCGAGCAACAAGAGGCTGCGAGTCCGCGCCCCCTGCAGCCCGACGCCGAGGAGCCGCTGGTCAAGAAGCGGCGCACCAAGAACTTCCAGCTG
CGCGAGGATCTGGCCAAGTCTCGAGGCTCCGTCACGGTCCATGTTCCCGCCTTTGAGCCCCTGACTTTTGCCACGTGGGACGAGTTTATTCAGGCCTGGA
ACGGCTACATGGCGCGTACGAAGACCATGTACCGCCGCCGCAGCTCGTCCACCACCACGTACTGGAATAGTAAGCACAAATTCAAGAAATACCCCGTGCC
GGAGGACTTTAAGTACGCCACCATGGCCTATTGGTGCACCCATGGCTGTATTCAGCCGTCCCGTGGCAATGGGGTACGTACCCATCTGCACAACCGGTAC
ACGGGCTGCTCGGCCCGCATCACGGCCGACGTGGTATTCGAAGTGGTGGAAGGAGAGCCCAATCGAGTCCGCTGGCTCGTGCGCGTGCGCAACCAGATCT
CCCAGCACAACCACCGTATCAGCGATGAGATCTACAGCTGCTACACCAACAACAGCTCCGTACCTGATGAGCTGCTGCTAGGCCCGGAGGGCGAGCAGAA
GCAGGAACAAGGAGACGACGCAGGTGAGGAAGATGGTTGCTTGCAGTAACGTTGCCAGAAGCTAATGAGTTAGTTGCTCGTTGATGCAGCTTATGAGCCG
TCGGCGCGCATCCTGACGGAGCTGGATCCGATGGCTGTGGATGGTGAGTGAATGTGTTATTACGAGTTGTGTACGTGTATTGATGCTGGGCTGTTTTATA
GCGGTAGGATTCACAACGAGAGGATCTACCGACTCGAAACTGAGTGTGAAGACGGCGGCGATCAACGCACCATCCGCAAGTATGAACTCGGTGGATTGGA
GTGATGAATGTTGGTTGTGCTAAGTGGTTTTTGGTGCAGCTGTGTCTGGGTTTATGCTGAAAGAGGCGCTAGCGAATGATCACAAAATGAACATGGCAGC
TTCGGAGATGCAGCCGCTCTTGGAAGAGCTGAGGAACACGCCGTCACGTGTGATTCACAAGCGTCTGCAGGATGTGGCGGAGATGGTCGCACATTTGCAA
GCGAAGTGGCACCAGGGTACATCAAATGAGGTCTTTGCGATACTCTTCGTATTCACTGCTAACTCATGTGATTTCTTACCCATTAGACCGTGTTGCTGAG
GAAGCCACGCAAGCTCATGCTGTCCCCATAGCTTCCTTAGCAGTTGACCAAGCTACAGCTGCGACAAGTGAAGCACTTGGCAAGTCCAATGCGATTGCCT
CGATCACCGGTCTGCCTCCAGGTGCCGCTTACTACCTGACGCCACGCGTGGAGCAGACCACAGCCGAAACAAGTCGTGCGGTCCCAACACCAGTGATGAC
CGACAACAGATCGGGTGATGAAGCAACCACCACTCCAGGCGACCGGGAAATGCCAGAAAAGAGCGGACAGGTACTAGGTAACCAGCGTGGTCCTTCTGAG
GCTGTGTAAGCATCTCCCCGATGTCGTTGTGAGTAAACAAGCTGCATTGATTGTCGATTATGAGTTTATGCAGAGTATGTGCGAGCGTGTTTGTGGTACG
TCTCCATTAATTAACCGTGATATTTTTGTCGGCATGGGAAGGTGATCCAGTTGAAGACACACATTGATCAAGGCGTTGGCATGCGAAACTGCATTCCAGA
AAAGACAACCTTCATTTTGGCGTCACTATTATCCCTGTCATGAATAGACACAGCAGTGCCAGCCGTGTTGGCACGTATGGTTCATCATGGGCCAAGGCGC
GCTATTTCATGAGCGGGGTGGTCAGTGCAGAGGATGAAGAACACAAGATAGAGGGCAATAATCAGGATGACAGCGACGACGGTGGGGATTTTAATGAGGT
GGCTGCGGAAACGTCGAGTGTGGCATCCAGCGAATGTAGCAGCTTCGTAACCACTGAACAAGCCACAATTACTGCAGTTCGGGTGCGACCCATGTTGTTG
TCGGAGAAGAAGAGCGGCTATCGAGTTATTGTCGACATGAGCACGAACGACGACGTTATGGTGACCAGAATTGTGAATCCGACAGCACTCCCGCCTGTGT
CTCGTGCCCGATGCACGCCAACAGAAGCCGTACACTTCCCTGTACAGTTCACGCAAGAGTTCTGGTTTGACTATAGCTATTGGTCTTGTGGTCGTTTGCC
TGCGCATCAAGAAGCCACGCAAAGCACAATCTACGATGAACTTGGTGTGCTTGCGCTTCAAACCGTGCTACAGGGCCGCAACTGCTCCGTCTTCGCATAT
GGACAACCCGGGGCAGGGAAGACGTACACCATGATGGGAAGCGGCGAGCTAACCAGAGCTAATAGCAACGGTAGCGCATCTGAGCGGCGGGGTTTAATCC
CAAGAATCTGCCAGGGTTTATTCGGTGACGTCGATGAAAGAGAATGTTCAGCAAACTCATGCACGGTACTCATGAGCTACGTGGAAATTTACGATGAAAG
AGTCTATGACCTACTTTCTCAAGCCACAGTCAAGGTGAGTCGTACTCTTTGTAACTTTCAGCGATACCAGCTCATGACGTGTGCTGTTGTTGTTGTACAG
CAACCTCTTAAGATACGAGAGCACCCAGAAAATGGTGCTTTCGTTGAGCGAGCACAGCGTGTAAAATGTACGAGTCACACCCAACTCTTGGAATTGATTG
AAGAGGGCAATCGTATGAGTTCGGTGACATCCATGCATAAAAGTGGCCGCCCTACTCGTTCACACACCGTGTTAACTATTTCACTCACACAACATGAACA
TGGAAGTGAGGCTCCAAGGAAGAGCAAGCTGTGCTTAGTGGATTTAGCTGGCAGCGAGCGGGTCGATCACTCTGCTACCAGTGGATCACGTTTGCGCGAA
GCTTCAAGTGTCAACCGCTCCTTAGCGACACTCGCAAGTGTTGTCGGTGCTCTAGCGAAGCGCAAAAACCATGACTCTCAACACCAGAGAACGTTCGCTC
CGTATCGAAACTCGGTGTTGACGCGGCTTCTGAAAGACTGTCTTGGTGGACGGGCTAAGACTATTATGGTCGGGGTTATCAGCCCGTGTTGTGCCCACTA
CGAAGAGTCAATTGCTACACTCAAGTGTATTGAACGTGCGAGGAGCTTGCACAGCACCGGCCGACTACAAGCGGATGCCAGTGGAAATACAGCTCTGAGG
TTGTTACGAGACGGCAACGAGCTTAAATCCAGCCTCTGTGCGTCGAACGAAGCCAAAATTCCGCATACGGTGGATAATGAAGTCCCCGAGCACAACGACG
AATGTCCGGGCTGTGAATCATGCGACGACGCAGATTTAACAACAACGCAAGCTCCACTCGAAGCAAAAGCAGAGGAGATGGTAAGCATGACGGAGAATAA
CGGTACTAAGTTGAAACAAAGAATCTTATCGATGGAATTGAGTGTCGAACGAACGGAGAAAAAAAGTTCTGAAGACCTAGTTTCACTGAAAAGTGCGCGC
CTGATGAACCTAGTTGCTATCCACCACCGCTGGCAGAGTTTACGTCTGTGTCGTGCCTTTGATCGATGGAGAGAGTTTGTATCGTCGGACACTAAGATTG
CGAAATGGCTACCAGTGAATCGAGAACGCAACAAGGGTAACGACGACGATATCAAGACTGAAGGCGTAGTTTTGCCTGAAAGATCAATTGGACAGGAAGC
AGGTTGCCCTCCACTGCACACACGCATGCCAACAGCTGAAACACGGACAGCAGATCGTGTACACGATGTGGTAGCGGCGGTTGTTGCTACCGATGCGATT
TGCTGCTCGGTGGTGCAAGATTTCCTGTTTCCACAACCTCCTAATTCACCACTACGGCAAGCAACTACGGCAGCTTCATCTCTCTTGGAACAACTGGCTT
CAAGCTCGGAGTTCGATAGGCCGTATTTTTCCTTAAACAACAACTCCAGCAGCGACGAGCCTCCACTGGAAGAGCTGGTATCACCTGACGGCTGGGATAA
TGCTGAAGAGAGCGAGTTGAAGTTATCAGAGAGCGGTTTATCCTCGTGCTCGCCGAAACCTCGTGATGAAGAGAGCAGCATTCAGTCAAAGCTGTCACTT
TGCTTGGACTCGATCGACATGGCCCGAAGAGCGCTAGGTCCGGGTGTTTATAGTCTCAGCAGCAAGATGATAAGAGACGGAACCGGGGTAGAATGCGAGT
TACTTCGGTATCTGGATAAGAGATTTATCGCGATGGAGTGGAACGTTGAAGATTTGATGGTGGCGGTCCAACTACATCCGCTATCTGCGCCACTTTTGTC
AGCTTTTGAACTTCTGGAAACAATGGTAGGCGAGTTCTGTATGCAGATTATTCCTAAACTATGCGATCAGCTTCCTAGTGCGTCGAGTGCTTGTGTAGCT
GGACGACATCAGCTCGAGACACAATTGGATCATTTCGGCTATCGACTAAGACGACAGCTTCTACCCGAGATTACTCGAGACAGCGACGGCTCAGCGACAA
ACAGAGCCAGTGTTGATGCTGTTCTCTTCTTGGCCACGGGCCTACTTGTGATGACGGAGAGGATAAAGATCGTGTGGAACTTGTCCGGACATAAGAAGCG
TGAACGGTTGCTACAAGCTCAGGCGCTAGAAGCTGCAGTTGTCCAGAACAGGAAATTGGCTGCCAGGATTGCAGATCTGGAGGAGCGCAATGCAGAATTG
GCTGTTAAGTGTAGTGGTGGGCTGGACGAAGGAAGATCGTCTGCAAATAATGTGGTCGCGATGGAGGAGCGATTGGTCAAGCTGCAAAATGAGCTTGAAG
AGGCTCACAATCATGGCCAAGTGCTTGAGAGTCAGCTTGTTGGGTGCAAACGCCTCAACCAGGAGCAAAATTCTGAACTGGAAAGTGTAAAACAGCACCT
CTCCGATGAGAAAGATGCCAGGTCCAAGGTTGAAGCAAACTTAGTTACAATGCAATTGCAGTTGGACGATTTGAAACATCAGCTTGCTCATGCTGAAGGT
CGACTCAGAGAAATGGAGGAAACCGCGTTCATCAAAACTGAAGAAAGGTGGGAAAATGTCAATACAGTTCTTATGAACGCCCAGACAAAGAACGATGAGC
TATCGGCATCACTTTCGAAAGCAAACAATGAGCTATCATGTGCTTTGGAGAAGGTTTGTCGAGCTGAAACCGAATGTAATTTACGAACAGAGGCAGTTGA
ATCCCTGGAAAGGAGCTTGACTAAAGCGCAGAAGCAACGAGAATCAGCCGAGATGCTTGCAGAGGATTTGGCAACTAAGCACACAGCTCTCAAGGACGAA
GTATCGATTCAATCCGACCAGATTTCTGTATTAGAATGGAGCGCTGGGCAGGATAAACATCGTTTATTAGAGCTGGAAGAAAACCTTGCAGCATCAGTAC
AAGAAAGCGACGAGCGTATGCTGTTGCTCTCCCAGACTGAAGAAACGCTTGCGAGTGCCCTTAATCGTGAAAAAATGCTTCAGTGCCAGCTTGTGGGGTC
CGATGCTCGCGAAACAGAAGAGATGAATCGCTTGCGTGTTGATCTGCACGAGGCAACGCTGGAACTTGCTTCGCTGCGCGACGAGCTTGCAGAACTACTC
GACCACTCTACGCTGCAGAGCTCAACCATCGAAACCCTGACTTTGGAACAGACAGAAACACTGCAAAGACTCCAGGATGTTGAAGCAGAGTGTGACGATC
TCGTACGTCAGTGCCAAGTCAAGCAGGGTGCGTTGGAGCAGGAAACGAGAGCGTACCATACACTTTCTCAACAGGCAGCGGCGGCGCTTTCTCGACTGGA
GAGGCAGCAGGAAAGTGAGCGCGAAGAATGCATGGCCGTACACGAGGCTTTGCAGCGACAAACGATAGATTTCCAGAAGCATCAGGCTCGACAACTGTCG
ATCAAGATGGACTATTACAGCACCGTTCGAGATCTCAAAGGACAAGTCGAGACTCTGTCGACAAAATCTCTTGCGATGAATAAAGAATTGGTTGGCAAGG
CGAAAGACTTGGACGTAGCCCTCTGTGAAGCCGAAGCTCGCATTCGGAAGGTTGAGAAACAGGCAAAACGCACTGTGCGCGAACAGGAAGAAATCGCTTA
CGGTCTGACTGAGCAACTGGAAGAATGCAGGACAGATCTTAAGGCGAGCACTAGTCGATGGATACGAGCAGAGACGCAGAGTGGAGTATTACGGGTTTGT
ATCAAGCGGCTTAATTGCCACTTAATTGAGACAAAAGAAGCGTACATGATGCGACTTGCTGACACAGAATCCTCTCAGCTACGAGACGAACATCTACACG
ATTTGACCCAGACCGAAGTAACTGTGAATAAGGACCTGAGCAGTCTTGACGCGTGGTTCGATGAAGTGATATCAGGCAACCAAGAGATTACAGACACGCT
ATCCACAAACCAGACCTCAACGATCCCAAAACCGCAAATCGAAGCTCGAGACGAGGAACGATTGTCGATGATGAAGACTCTGACGGACCTGACTGTTCTT
ACTAACGAATTGCTAGTCGTATGTGAGAGTTCGCCTCCTTCCAACAATTTGTCAGTCGAAGAGTCTGATCATGCCCCAGAACATCACGACACGAGCAAGG
GCACAGATGACTTGGAACAGGAATTAGAGTATCCCCAAGAAGCAAATTCCGCTAAGGGAGATTGCGATGACCAAACAATAGCAGGACAGAAAGAGAAGGC
ACTGATTGAAGTTATTCAACTAAGGTATGCTGTAGAGGTAGCTCTTGATGCACCTTAAAAACTCATTCTGATTTGTGAATATTTGCAGAAAAACCGTGAT
GAAGTTGAAAGAAGCTCTGGATGCTAAAGACGACATGCTACTGTTCCTCGATGGGAAAGTTAGGCATCTCGAACAACTTTAACTTATCTATAAGTATTTA
CTTACAATTGATGGCAAATGTTTCGCAAATGCTTTCGGTTTCGCAATTTGTTGTATTACTATGTTTATAAAATGATATTATATTATTATTTTTCGAAAAA
AAGCATTACTAAAATTTTGATTTTTTAACATTTTTAATTAGTTCTATTTTTTTTTTCCACTCTCCAAGTGATCCCCATTGTACCAACATGAAAGTGGTAG
GACACTGCCATTCGGAGAGGGCCTCTCTCCACTCTCCTAGCGAACCCCGTTATACATGTTCATGCTCTCCAAGTAACGCTTTGTCTGCTGTACCTCACCC
TCTTTTTTATTTCTCCCAACGACGCTCTACAGATTCAATTAGGCGGCGCGAACGATGGATTGTGCCATTTTTTGAGCTTTGGCGGCTATGAGATGCTTCT
GGACTGTGGAGTCAAGATGCAGTCACTCCAGAAAAGCCCCAAACAAGGCGGTGGCACTATCTATCGCCTACAATTGCCAGCACTGAGCTCCGTCGACGTG
GGGGCCCTGGACGTGGTGTTGCTGTCGAACCACCAAACTCTGCTGGCTTTGCCGTTCTTGACCGAAATTTTAGGTTTCAAAGGGAAAATCTATGCCACAC
AACTCACTCTCGACTTCGGTCGAGTGTTTCTAGAGGAGCTAGCAGCTCTGAATCAAGGGGATGACTCGGCTATCTTCACTATTGAAGGTGTGACGGACGA
AAAGGAGATCCCTATGTCCTCGTTGAAGGAGATTGAGGAATGTTGCAAGAAAATTCAATGTGTGGAGTACAGTGAGGTGGTCTCCTTAGCCTACGGCGTG
CAAATTACAGCGCTGAGCTCGGGGTTTAGCCTAGGGGCCAGTATTTGGCTCGTGGAAGGACCCAACGACAGATTGGCGTACGTGGCTGCAGCATCGGGAG
ATTATAATCGTCACCCAAAGGAGCTGGACTTGCTGCCTCTTGTGGACTGTGATACGCTGCTATTGACAGATTTAAAGCCGGATCGGGATCCTCATGCCAA
CACGGAACGCATGGTAGAGCGTGTACTTAGTGGAGTGTCGAGGGTGCTTGAGCGTGGCGGCGTTTGCATCGTGCCTACGTCTCCATGTGGCGTGGTATTT
GATCTCGTGGAAGCGTTGTATACGGCGTGTGTTCACAACAAACAGAGCGTCCCCATGTATTTTATCTCGGATTTTGCATCGCGTGTCATGGAGCTGACAC
AGCTTGGAGCAGAGTGGCTGTGCGAGAAGAAGATCGAGAAGTTGTACGCCGGTGAAGATGCGTTCCTGCACGAATCTCTATTGAAAAGCAACCTGTTCCA
CGCTGTCACTGACGTTTCAGCTGCCACCGCTGCTACTTTCCAGGTATATTCCTCTTAGTTTGAGAATTTGATTAGAGTATGTGTAAACTAACTTGGTGTG
TAGAATGGCAGTATTATTTTCGTAGGCCACCCCTCTCTCAAGTTCGGACGTGCTTCAGAATTAATCCAGATGCTGGGTAACGAGAGTCGCAATGGGGTTC
TTCTGATCGGTACGCGCTTACCAAAGTAGACCATGGATATGCTTGATGTGTAATGATTATGTTGTTGTAGATCCGTCTATCGACGCTACGGAAGCCTTTG
CTCCATTCCAGGACCTTCCGATTGAGAAGATTTCGTGTCCCATTGACCCGCGATTAAGCTGCGGCGACGCTAACCAGTTTATCGCGCGCTGCTGTCCCCA
CAACCTCATCGTTCCGTACGAGTATACCGTCGTGCCGCCTGCAAGTGCGATGGACGGAGCTGAGATGTCTTCGCACTTTTCGCGCGTTCTTCCTCTTCAT
GAGCTTACTGCTGCAAAATCCAAGACGGAACTGCTTACATTCCCGATGAAGCAGTTTGAACCAATCGTTGTCGAGAAGACGTCCAAGTATCTCGATGGAA
GACTCGACCCCAAGGTACAGCATTGCTATGTACGACCTCATGGATTAAAAATTTGCTGATACTCTGCGTTTGTTTTATCTTGTATAGCTTGCTGCGCTGG
CCACTATTACCGAGGTAAATGGGAAAGCTGCAGCTTGTGTAAGTGGCGTACTCCGTGTCAAGCGGAAAGCATTTGTGCTGGAGCCTCCCGTTGATCCTGT
CACACCGGACGTCAACGACGAGAAACTTAAGAGTACGGGAAAACGTAAGGCCTCGTCGATCTCAGAAGGAGATTCCAACAATGCACTTCAGAGCATTGTC
TACAAGGAAAAGAGCAACCTGCTCATGGGCCAAGTGGACGAAGATAAGCTGGAGAAACAAGTGAAAACGGTAAGCGTCATGGTTATTCCAATGCATCCAC
GTAAGATATTCACTCACAGTTTATTATCGAATGTGCTTAGCATGATCCACAAGCCCAGGTGTACATTTCACAGGGCCAGGGAGATGCAGATGTGTTCATG
AGTATTCCATCCCTTGACGCCCGCATCACATTGTGGAAAGAGACCGGAAAGACACTAGTTGAGACAGAGAAAGAGGATGCTCGAGCCTTGCTGACCTCAT
TCATTCTTGCTCAACTCGTAGTGATCACCCAGGGCTAAACAGAACGGCGATTTGAGTGAATCTAATTTTTTGTTTCGCAGAATAGATAGCGTCATCCATA
TGGAGTCTGTGAACGTTGTTGCACTGCCAATTTCTTGACCGACGGAAGCGTATTTTTGGCTGATTGTGCTTCTTTCGACGGGACAGCAACAAGGGTGAAG
ATGGAGCGCGTAGAGGATGGCTCCAGCATGAACGTCGTTCCGCCAATGTTCCATGCTGGTACGTCTGGAAGGTCATTTGCTTGTATTCGTCGACCGGAAG
TTGACCAGATTCTACTGTTTTAGGGATCTCAAACAAGTTCACTAAGCGCCACCACGGCAACTTCCGTGATACAACATTAACAGCAGCATCTGCAGCTAAA
GAGCGAGCCGAGCGGAAGCTTGAACGACAAGCAAATGCGATCGAGAAGCAGCAGCAGAAGATCGACAATGAGGTGAACGATAATGAGGTGGCATGCTTGC
TGCATCTAAATTGGGTATTAATGCGTGATTGTGTTGTACTGACCTGGCAGATAAAGAAAATCGCCGAGATTACTCAAAATCTGCATCGTCAACAGCTTCG
AGAGGCGAAGCGTCTTCGAAATCGACTGAACTATGCCGCTTCAAAGGTTCAAGCTGCTTATCGCCGATATTTTGCTTATTTAAATCAACAAAAGCGAGAG
GCTGCTGTGAGTATCCAGACTTTATCTCGTGGATTTTTAGCTCGACGATTGAGTTGCAGACTACGAGCACAGCGCCAAGAGTACGAGCAAAACTGCTCAT
CAGTGATTATTTCAAGGTGCATTCGGAGATGCTCCGCACGAAACATACGCGCTAATGAGATCAAGCGCAGAGATTCGGCAGCTCGCAGTATACAGAGTAT
CGTTCGCATGGTTGTTGCTCGATCTTACGTCCAAGAGCAGCGACGACAGCGACAAGAAGCGGAACTCCAACACCGAGCAGCCATTGTGATTCAATGCAAC
GTGCGAAGCTTCATGACTCGATTGATCTATCTCGACGTACTCTACTTGATCTGCCGCATTCAGGCGGTCATGCGTGGATGCCTCGTTCGGCGACAGTTGC
GGTGGCTTCGCATCTCCGACGTGGATGCTATATCGAAACTGCAAGCTCATGTTCGAGGGTATTTGGTCAGGAGAAGGCTAGAAAGAGAACAAGAGAATAT
TGAGCACAAGTCTGTCCCTACCAGCCGATCGAGTCATGGCTCAGTTCG