Description :
From Genome Similarity Track
Location :
Scaffold_375:82322- 84703
Sequence
2381 bases(100 bases per row)
TTCACTCCTTCCTCGTAATCCACGCTTTTCCTGTAGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCCTCCTCCTCCTGACCCA
CAACCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACAATAATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGA
ATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCA
ATACACTAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTTCGAGCTCGTCGGCTTCGCGATCC
ACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGA
CCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTACGGTTTCCAGCTTTACCGCATGTTCTCCTATCTAATACGCTCACCC
GGAACGGTCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGG
ACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGGATCTGGCTTGCCTGTAGTATTTCTGGACTTAG
TATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAA
ATGGGGTATCACCCCGGATCCTGTCTTGGGCAATGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTA
CATCTTGAGTGCTCTTGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATC
CGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCTCCAAATCTTCGGAAGACACACTCCTCGTACG
ATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTACCCGGTAAACAGGTCCACTCAAATCAACAATTCTGTGTTTCCTTTGAA
CGACTTGGGGCAACGAGGGGATATGATCCATGGGCTACGATTTGGAAAGGGTAAGTCGCTTGGATATTCTTAGGTGACTCCCCTTCGATTGTGGGCCTGC
CCTTGCCTGTCTCACAATCCACACATTCCCTGACATACCGTTGTACGCTCTTGAATAGTCCCCCTCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCG
ACCAATATCCTGGTGTCCGCCTTTCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGA
TCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCCTCCC
GACTTAAGTCTCGTACATCTCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCTCAC
CACAAATGTTTCCTCGAGGATCTGGTGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAAAAAAA
AACCACTTCGTCTAGTCGATTCAACGTAACGAGATCCTGATGCTCGACCTCTCTCTCCGCTTCAACACCACAATGATTCCGTAAAGCGGCACTGGTCAAG
CTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCAGTTTCTGCCGTAACAGTGTTAGGG
CCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATTTTGTCCCTTTTCGACAAA
CCAAACCCAGAAGGAGTCCGTTATACTTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGGCATCTC
CACAGTATTGGCACTGTATGCTCCTCCTCCGCGTCTTATACGAGCGGATCCATCGAAACTCCAGGAGGACGATCTTCATCC