Description :
From Genome Similarity Track
Location :
Scaffold_316:82303- 88799
Sequence
6496 bases(100 bases per row)
GTAGCGAGGGGATGTAATCCATGGCTACGATTTGGAACGGGTAAGTCGCTTGGACATTCCCTGGAGACTCCGCTTCGATTGTGGGCCTGCCCTTGCCTAT
CTCACAATCCACGCATTCACCGATATATCGCTGCACACTCTTGGATAGTTTCCTCCAGTGGAAACATTCCTGGATTTGTTGGTAGGTTCGACCGATTCCC
TGATGTCCTCCTTCTAAGTTAGCGTGATAGTGATGTAGGACATCCTGTTGCAAGGTTTCCGGCACCACCAATCTCATCAATCCGTCTCGTTCATCGCTGA
CTCGTTTCGGAGGGGGATACTAGAAGAGCAAATCATTCAGATTCACTACATAATCCGTAGCGATAGTACTGTAGGATTTGGCGTCCTCCCGACTCAGGTC
TCGCACATCCCCCATCAGATATTTCTTTAGCCCCAGAATCCACACTTCTTCGTTCTGTACTTTGAGAATCCGCTCAATACGGACTCCCTTTACAAATGTT
TCATCTAGGATCTGGGGGCCGGATCCAATTCTTCCTCTGGATCTAGTGACAGCTATTACCTGGACCGTCCTCTTCACGGATTCAACCAGCACCACTTCGT
CTAGTCGGTATAATGTGACGAGATCCTGACGCTCGGCCTCTCTCTCCACCTCGACACCACATTGATTTCGTAAAGTGGCACTGGCCAAGCTGTCCGCACT
GGCATTCCGATCTCGCTTGACATGTACCAGCTCGTGATTCTTTTAACCACACAGGTGAGTCATCACCTTCTGTCGTAACAGCGTTAGGGCCAGGGCCTTG
CAGTCAATTTCGCCTCGCACCTGTCTGATCACCAAATTCGAATCTCCACATATCACCAGCCTTTTCGGATCCTCTTCCTTTAGCAGATCCAAACCCAGCA
AGAGTCCGTTATATTCCGCTTCATTGAAGGTGAGGCCTTCCGCGTAAGTGGATCTGGTCCTTACCACTTCATATCCGGGCTGTTTCCACAGAATTGCGCT
GTATGCTCTCCTTCGCGTCGCACGCGAGCCGATCCATCGAAACTCAGTACGTACAGATCTTCATCCACTCGTACCGTCGGGATCGGGATCTGGATCAGGC
GTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGTGCTTCGGCTCTGGGCGTGATGCTCGCGGCCAAACCTCCCAGGATCTCGTCTTCTCCTTTCGAACA
TTTTACGATCTCCAGTGTCCATGGTGAAAGTAAGGCTGTCCATTGTTCCACCCGTCCTTGTAGACCGGCCGACTTAAACAACCAAGCGAGCGTGGAATGT
CGAGTCAAGATCCGGATGGATCTCCCCACCAGCAGGTTATAATTAATATCCAACACCTGCAGAAGCGCGAGTATCTCCTTCCCCACCGCTCCGTAATTCA
ACTCGTCCGACTTTAGCGTTTGGCTGATGAAGGTGACTGAATGGCAGATCCCATCATGTTCTTGTACCAAAGCTGCTGAGACCGCTCAATTACGAACATA
GACTATTACCGTATGTTGAAGTTTCTGGATCAAAATGGCGAAGGGTGGGCGTCGTCGCGATCCTATTCCTTACCGCTACGAACGCGTGCTGAGCTCGGAT
CCACCGAGGCTCCACCTTTTCCGAGCCCTATCCGCCAACTCTGTCCAGATTGGATCCTCTCTCCGTTGGTCCCGGGATGGATCCAGTTCCTGTTTTAGGT
CGTCTTCCGGCGTCGTACTACGTGGATCCCCTCGTGGATCTGTGATCTCTAGGGCCAGAGCTTGTTGGATCTTGATCCAGACAGTCGCAGTGGCCATCGC
AGCAAAATCCACCTCCCTCAATTCATAGAGTACTGCGGCAAAAACTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTACCCAAGAAGGATTAC
ATCGCCCGTAATGACTGTGGGAAGGACAAGTCTGTCAACGAAGCCAGGTCCTTAGGATTCGCCTTTAATCCCCCTTGGAGACTCGATGACCTAAGTAGTC
CACCTTGCGCATCCCCCAATAGCTCTTCACCAGGCTGATAGAGATATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAGCTGATCC
CATGATTCCGCCGGGATAAGAATGTCGTCGATATAGGATCTGCGTCATAACACGGATGGAGTCCCCAGATCCCCTGGCTCTCCTGCTTCGAAGGGATTCA
CTTCCGCATGACCTTCCCCGGATTCACCTCTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGC
GTTATTCAATTCAAACGGCATCCGGCTCCATTCGAATAGCCCAAATGGTGTGATGAATGCGGATAATGCGCAAGCACGATCCGTCATAGTCACCACCCAA
AACACACTTGTTTTACTGTTTTATCTAGAGAACAGTACCAGAGCACTTTATCCAGATCTTCCAATAGCTTATTGATTAGAGGCGTCGGGTACACCGTCAA
TCTGGTCAGACCGTTAACCATCCAGTAATCAATACACAGACGTATATCCACTCCATTCTTCTTAACGATGATTACCACAGGAGATGCACACGAGGACGTT
GAGAAACGGATGATCTTGGCTTGCAGCAGGCCCTTGATCAGATCGGAGAGCTTTTCTCGGAACTGAGGCGCCACCTTCCGCACCCTTTGAGCGATTGACT
TCGCATCACCGACATCGATGTCACATTTGACTCCGCGTGCAGCTGGTGGTAATGCATTTCCTTTGCCAATTAGCAGATATCGGCTTTCCCAGATTTTCTG
ACGTAGTCGGTCCACCTCCGCGGGTTCGTTCGCCCCCCGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTTCGGGATTAC
CGCCATACCTTTCCCAAGATCTTCGGCGTGTAGATCCCCGCCTTCATGGTAGCAGACTTGTTCATTTTCAGTCTTCGTCGGACCCACCACTGGATCCAAG
CACCGCGACTTCCCCTCTCCCGTCATTCCTTCTGCCTTCATGGGATCGAGTATCTTGGTACCGGGGAAACTATCTTTTGGATCGATTCGATCTTCTGGTG
AGTTTACACACGACGGCTCCTGTTTAGCCAGTTTTGACACTCTCGACAGGGATCAATGCATTCTATCCAATAGAAAGTTTGGATCCAACTGCGGGTCAGC
AGGTTCCAGCGAGCCAGTTTCAATTCCCTGCAATTCCCCATCCACCGACCCTTGGATATCTAGGGACCGGTTCTGGGTTTCTCCAGCTGTCTTGAATCCA
ACCTCTACCACTTGGATCCCAATCCGACGACCCCTCTGTAGGATCCTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCG
GAAGTTCCGCCTCTCCGAAAAATTCGGTCTCGGTAGTCGCCTCATACGCCAGATTCTGCCATTCCCTATCCCTAGGCGACCTGGATATGTTTCAGTGGGA
TCCCGTCGCTATACCAACCTTCACCAACCATCGCCCAATCTCCTCATAGTGGTCCAATAAAAGTCTCTTGTCGCTAACATTCGTGACTTAGAGGTATTGC
GATCGACCTGGTCCTTGGATTACTGTAGGCACCCACTTCTCACCCCAAGTGAGCCACAGTTTCTTATGTTCCACCCATTTCAACCGATCTGGCAGTTCCC
AGGTCTCTCCGGGCTCGTTCCAGGTCGTCTGATCCGCCCTTATGATCCTCATCTTCGTCCCGTACAACGGTCGTCGACCACTGAGCTGGAACCGCATTTC
GTTTAGGAAACACAATGTCCCATCTGCCAGATCCAACCTTACTCCGGCTGGTACCATAAAATCCATCCCCTGAATAACATCTTGGCCAGCGAGGTCTCCG
ACCCCAATATCGAGCCAATACACTAGACAGCCCGCCAACGTGATCTTACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCGAG
GAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACAGGTCTCCCCT
GTTAGCAGATCCATAAATCCAATATCCTCAGATCCACGGGATCCAGTGACCTGACCGACCTTAAGTGGATCTACAGTGACCTTACCCTTGGTAGGCTCAA
ACCATTGGCCATGTTGTCCTTTCTCCCAGTAACCGCGCGTTTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCGAATTCATCCACTTG
ACGCAAACTAGAAACCTTGGAAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGGCCTGCTACCTGGATCTAGCGATGTCTTGTTC
ACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCTGGCAACAT
CCCTCTGTGCTTGGCTGGATCAAACCATTGGTGGATTTGGCTGTAGAACTCTTCTATCGGGCACTTGCCGGCGTCGTGGGTCTCACCACAACCGCGACAC
ACGTAGAAGCAATGCTCCCCATGATGACCGTTCCACACTTCTCACAAACCAGATGTTTCCAACATCCAGCTTCTGTGTGCTTCCGGGATCCACACTTCGA
GCACCAGATTTGTCCTGTCCCGTCCATGATATCTCGGGAGCTGTACATCCCACGGACCCCGGGTACGGTATCGCCAGTGCGAGAGTTGTCTCCAGTCTTC
GCCGTACGATCGTTGGGCGCAGTGAGACAGACTCTGCGGTAATCTTCTGAATCGGAGTCCGAACCATCGAATCCCGATTCAGTTCCTGAGTCGGGCGCCG
TGACGTGGTGGATACGTCCAGCTGGAGCCGTGGGTGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGTCATCTTCTTCTGGCGGTGTGTCGCGCG
ATCCACATCCCGCAGCACTTCTTCGAGTTCATCGGCGTCTAGAAGACGTAACAGGGTCAGCCTGCCGGCCAGATCCACATCTCCCAAAGTTTCGATGAAA
TGATCCATGTGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTCAGCTGATGAAGATACTCTAGCGGAG
GCTCGTCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCTACCGACACTCCCAATCCACAGTACTGAATCTGGAAACTGCGCAGCAAATCTGGCCACTT
GTTCCTGGTGGATCTACCCAGCTGCCGATACCAATTTCGGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCT
CTCATGAGGGCTGACTTGACTTTGCTGATCCATGTTCTCGCTCGATCCTCGTCATGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGACTGAGATCC
GTATCCTCTGGATCATAGACGATCCATCCGTCCCGGCTGCAGCTGTTGCCACCGCCGCTAACGAGGGGGATGGAACATCCAGATCACCTGGGTCAAACTC
ATCATGGGAGCTGTCTCCCTCCACTGACTCCATATCAACGTCTCGTGCTCCATGATCATGGAACACTTGCGTTTGTGGTCTGGGTATTTTCATACCGTAT
TCGGCCAGGAAGCGACTCATCGCAGATTCAAAGTGTCGTTGCAGGAAGCCCGAGGAGGTGTCGTAAGAGCCTGTAGCCGTCTGGTCTACTGGCGAGACAG
GATCCGTGAGGCGATTACTTTGAACCCGATCTGACGATAATCCCACCGGCTTCTTGCTGAATCTGGCTCGATCCTGGTTGGATGGTATCAGAGCACGGGT
ATGGCGTCCTGGATCACGAGTCTTCACACTCGAGGGCGCTTCTTGTCTCCGGTTCCTCGCCCGCGCTTCCAGCAAGGATGCCCCGGAGGGTCCCAAAGTC
ATGCGTCGGGGCTCGGACGACGTGTCTGACCCATCCTCAGCCGTGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGTGACAACACTGCATTCA
TAGTGTGCGACTATGTAATGGACTTGACTCTGACGAAGAGGCCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGCAGATATCCTCTGCGTCGAA
CACACCAGCTACGATGCCTGAATCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCAGTTTTCGTTGGTGCTCTCACCGGTTCCCTC
GGATCTTCGATCTGTCGTGGATTCAGGATCCGCATGACAGGATCTTGATGCAGAAAATCGCGTAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGT
CTGACCAGCTTGACCTGGATTCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGGCTTCTTTCTCG