Description :
From Genome Similarity Track
Location :
Scaffold_209:823- 4025
Transcript NameFunction/comments
Phyta_totarag5622hypothetical protein

Sequence
3202 bases(100 bases per row)
AAATGCGCCTTCTAACGTGGATTGTACGGTTGGTTTAGCCACTCCAAGCGCAATCGTTCCCATCAggcttggccttcatcaAACGCAAGAACATCTTACC
CAGAAGCACACTTCTGATTCTTCGCATTAACGACACGACTCTCGAATCTTGCCGATGAATCTTCAGGCACTCGTCATACTAGTCGCCGCTGGACTCCTCT
CCACGAACTGCGACTCCATCAACCACGACACCGTCGAACCGATCGTCCAGCCCGAACCAGTCACCATTTCTGAAAGAGCGGCCGTCAAGTTCAACCCCCT
ACTCAAAATTAACAACGAAGGGTGCGCCTCGTACCCTGCTGTAAACGCTGCTGGCGAGACCAACGGCGGACTGAAGGGAACCAAAGGAAACGATGGCTGC
AAAGTTTCTCTCCTAGGCTCTCAAGTTTATGGCAGAGCCGCGTGGCACAACGACCTCTATGCCATCATGTACGCTTGGTATTTTCCTAAGAGCTTCTGGT
GGATATTATTCGCGTCGGGGCGCCATGACTGGACAAACGCGGTTGTGTGGATCGACAATCCTGAGTTGGAATCACCCAAGATTGTGGGACTATCTGTATT
GCAGTCTGATACTTGGTAAGTCAACTACGCACCGCCGGAGAAATACTTCTTTGCCAATGGCACAAACCCCAAGCTTATGCATTACACCACTTACATGCAA
ACCACGGAGCAGCTCGGTGATTCTCAGGATCTCATCATGTGGAATCAACTGACTCACGAGGCACGGACGGCATTGAACGGCTCGAATTTTGGCAAAGCAG
AGGTGCCGATAAATGATGCGAACTTTGTTGAGAAGCTCGACAAAGCCTACCCGTTGTAGATCTAACGGCGACGTCATTTTCCAGGTAGAAATTGATATGC
AGTGGTCTGTGGCCCTTTGGGAGCTCAAACATGGCCACGTGAAATCTGAATTGCTCTCAACGTGCCAAGATAACACAAGTTACTATCGTTAGATTGATCA
TTTCATTCGTCCGCTTCACGACAATGTTTAAATCTTCGTTTCCGTACGTCTGCAAGGTGCTACTGGtcctgcttcagcatcaatGAGTAATTAATTCACC
CGATTCCTTTTACTTcgtcactacatgtaccaaaTTGAAGCTATTGCCATTATGAAGACGACATCCCCTCCATATTACTGCCCGCTGCTTTCACACATGT
ACTCACAAGTCTGCCATAGCAAACACTCAGTGATGGAGATCGTCGCGGCGAGAAGATAGCTTGTCCTACGTCCGCATTATTAACAGTTGAGACTGTCAGT
GCTGACGGCGATGGAGAGAAGGAGGCAAGGAGTGCTAACCACCTGTTCGAACGGTTCTAAAGTGTCAGCTAGCTTGTCGTCAACGAAACGTGGATAGTAA
ATGGTACCGGTAGTATCCGTGGAATAAATTGCGTCTTGACTGATGTGTACAGTGCGTTGTGACATCAAATCCACACAACAACCATGCCGCAACGCCATAG
TCCTACGTTTACGGAATAAACTGAAGCTGCAACCGGACATTCTATTAATACTACATGAAGTAACGTTCTATCTCGTGCTGGTATTTCCACACTCTGACTT
GATTCAGTTTGCAGTTATTTGTGCTGACTCCATGGCTTCATCAGAATTCGGCGAGACACTTTTGGTTTCAACTCGCTACCAAAGCGAGGTGGGAGCACAT
ATTCACTGTCCCCCCAATCTGTACCCGCAGTCCCTCTATCATGAATACAAGTCGAAGTGCTCGAAGCGACTATTCAACGAAGAGATGTACACAAGTGTAA
GAGCAGGCGGCGCGAGCCATGGTTGTTTCTCTCAGTAAAAACAAATCTGGAGCAGTGTAAATTGTCGAGTTCATTTCAGGAGCGGCATACCAGGTCCGAT
AAGTCATCAACACGATCGCGGGGATCTCTCAGTCAGATAGAAATCAACCACATCATACAAGGCGAAGAATAGGTGCGTCAGGCGATTCGTGACATCCATT
TGGAACCTAACGAAGTACTGGTAAGATAAACCACTTCTTCCAGTTTAGCTAGTAAAACCTCGTCCTGTTAGTACATGATTCACGTATCGCTGCCGTTCAT
TGTTCCCGTCACTTGATGCTATGATGACTTCTGGAAGACTCCGGCAGTCTTTGCGTCAGTGGCAATGGTACGCCGAAGCGCATCCGTTCGAGACGCTCTG
CGAAGTGTGAGATGGGCCATCAGGCCAACAGAAGGAGGATGGTTGTGTTCATGGCTGTCCCTCGATACCAGCGCTCACCAACTCCATCTACGCGGTGTAC
GCGAACCAGATGGTCTGTATACTTACGTCGAACACCGTGCCAGTCGCATTCATCGACGAGGCTTCTTCTACCTTTCATGTCCTACTTCATGCCGCAACTG
ACTTCGACGTAGCCGTGGCTGGTTGCACAGCAGTTCAACGCTGCTTGGGCAGCCTTAGCGGATGCAAAAGACGACTCTGGAATCCAGAGTCAGGGTGGCA
TGGCAGCCTCCACACACGCTATCCCTGGGTAGAAATCTGCACACGCTCCGTGTGGCGGCGTACCTTGTGCGAAGAATGGTTCTGGTAAGTAACTAACGGC
GCTTGGATGGAGCGCATACATTTCAATGAAATGAAAGAAATGGACCTTGACATTATTTCATGCCCCGAAAAGCCGCGTCTTTCTATCGAACGGTCGCCGA
GGGGACAGCGGGTACAGATTGGGGGGCAGTGTGCTCCCAAGCGAGGCGTTTGACGGTTTTCTTTGATCGGTTATACTTGATGCGTGGGCCCACACATCAA
AACTGTTTAcgcgctacatgtagcaactCATACCAGTTCTCGTCTGTATTCTGCTTTTTCAGCCACCAGCAAGCTGCAAGTCACTCGTGGAGTCCGATGA
TCAGCATTTTCCAAGATTCCAATAACCCAAGAGTCGAAAggctcaagaagaacgggGCTTAAGACGAATTTCCAACTCCGACATTGTCAAATGGAGATAC
CGAATCCCAGCTTGAACATTGgttcgtcgacgagaagCACACGCGCAAGCAGAAGGCGTTGCTCGCCATTGCACAATGCTGTGTTAGACGGCGATATCAC
TCTGGTGGAGCAAATTCTCCGAGCTGGAGAGAACCCCGATATGGGCGACGAGGGGAACTTGACCCCAATCATGTCGCTGTTCATGCGCCATAGTTTGCAA
GA