Description :
From Genome Similarity Track
Location :
Scaffold_179:823- 2691
Transcript NameFunction/comments
g11499.t1hypothetical protein

Sequence
1868 bases(100 bases per row)
GAAAGAAGAAGCACACGAAGACTAGCCGTCGAGATCGTCAGACGGCCGACGCAGAATCCGCGATGGAGCCACGAAGTGAATGGTGCGATTGCATACCGAT
GCTGTATAATGCTGCATGTGCCGATACTGACAATGTTGTATATGGTGTGATCTGATTGAAGCGAGGCATCGTCCAGCGGAGCATCAGCCCAGCCTGCACC
TGCCCGAGCCCAGGGTGCCCCTGCATCTGCCCCTGCACCTGCACTAGCCCAGCCTTCACCTGCAACAGGCTCACCTGCTTCCACCATGTCACGCCAAGCG
GCCAGGTAAGTTTGCCCTGCTATGTTGCATATACGACATGAACCTTGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCATGTGT
ATGAGGAAGCGTAGGAGTATTTAACTTCAGTATACTTGTATCCGCAAGTATACTTAAACTAAGACAAAGGGACCGAACGATAGCTTTGGTGCTAAATGAG
AACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGGGGTTCTGCCATCGGATGGCTGGCAGAACCCCTATCTACTGAATGAC
TCTCATTGATAGAAAGATGTTGCTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGGGTGGTCACCTGAATGTATTCCTTAGTGC
ATGTTGAACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACAATGCTGACAAATACTACGTATATGAATTTCAGATCTCTAGATTCGGATCATAT
CGAGACCGACGAGCATGATCCCGACGTCTCCATTACTGCCGCTATGGACGCAACTGATGTCTGCCCTGCGAGGCTCGAGCAAGATTTCGATGGTGCTTTG
AACTCGGACGCGGAAGGAATTGCAGAATCGGACGATTGGTATAGCGAGATGCAGGTTGACGTAAGTGATGACTCTGATACCGGCGACGACGGTTCCTTCG
ACCTGGATCCGGACGGCGACGATGATGGAGCGGTGGACGATAGTTCTTCGGACGACAGTGACGTGGAACGGCTCGGAGCTGCGATCCGTACTCGTGAGAA
GAACCGAGATAAGCGAAAGCTGCTACGGGAGCGACTGGCAACAGCAAAGGCGAACCTCTCTCGCGACTGGAGCGAGACGACCGACAAGTGGGATACACTA
ACCAAGGAAGAGATGAAGGTTCTTGCGCTGGATGACGAAGCGCTGAAGAAAATGCTGAATGATGCGTGGAACTTTGGTAAGTCCTGTGTGATGGTCTTGA
TGTTGTATATACTACATTGGACTAAAGCGTGATGTTGTATATTCTGTAGATGCCGCATCACAACCGGTTCGAGCAGAGTTATATCCTGGCTTGTACGATG
GGGAGTATGGACCAACCGCCGAAGTGCTTGAACAAGCTGAATCACCGCTACGCCTCTTCTTCTACTTCATGCCCCCTCGGCTGTGGCGCCGCATTGCTTC
GGAGAGCAACCGCTACTATGATCAAAATCTCAACGCGCGCATGGACAGAATATTCGCTGCGTGTCAAGTGAGAGGAGATGACGTTTCCCGAGATGACGTG
ATGATGAAAGAGACGAAGAACCACAAGAAAATTCAGTCTGAGGATGTAATACACTGCATAAGCTTGCTCGTTGCGAGAATGCTGAACCCGCACAAGAAGA
AGTTTGCCGACCATTGGAGCACGCATGGAGTGGGGGCTGTGCCAAAGGACGCCTTTGGAGCTTTCGTGCGCAAGGCTCGGTTTGATCGGATCATGCAAAA
CCTACACTTCACGAACAATGCCGACGCACGTGCGGAGACCGACCGGGCATGGAAGGTCAGGTCCGTGG