Description :
From Genome Similarity Track
Location :
Scaffold_5:822828- 824487
Transcript NameFunction/comments
Phyci_89798Hypothetical protein

Sequence
1659 bases(100 bases per row)
GCCGGCAGCCACGACGGCACGCACAACGCCGACGTGGGCACCAGCTCGTCCTCGTCGTccgccaccgccggctccagcggcacgtccacctccacgacca
cgggcagcgccgacacgacgggcagcgccggcgtctccacgacgacgaccccctcgtccaccaccaagacgccgtcgtccaccacggccacgccgtccac
caccacggcggccagcaccaccacgaccagtgcgtccaccacaggaacgacgacgtccactgcgacgagagctccgtccacagcgacaactacgaccacc
accacgTCCTCGGGATCCTCCGGCACTGCGGCGGGCACGACGACTGCTGGTGCGCGCAACCTGCAGGCGACGACGACTGCTACAACTACAACAACTACTA
CCACAGGTTCGACCACAGGAACGACAGGAACGGTGGGTACTTCCGGTACGGCGACGAACGGAACGACGTCTACGACTGGCACAACCACCTCAACCACCAC
GGCAGGCTCCAGCTCGACGACGGCCTCGGTGGGCTCGGGATCGTCCAGCTCGGACGTGCTGTCGTGCGACAGCACCTTCTACTCCAAGTGGGACACGCTG
GGCCTCAAGTGCGGCGGCTCCAGCATCGACGTGAGCTCGGCTGTGTCGGCGTCCAGCTGTGTCATCTACAGCGGCACGGTGGGCACCACCTCGGGCTCCA
CGTGCGTCTCCATCTGCTCCTTCCCAGCGTGCACGAACAGCGCCTGGGTGTACGGCGCGGACAACGGCATCTCGTCGTCGGTCTACGACGGCCTGACCAT
CGAGTCGTTCCTCACGAGCGAAGTGATCGCGGCTCTGAAAGAGCGTTCCTCCACGGTGTCGACCTTCCTGTCGAATTCGACAATGTCGGACTCGGAGCAG
TGCACGTACTCGTCCGAGTCCTCGTTCTCCTCGTGCACGTGCTCGGCCATGCTTGTGGACAGCTCGGCCTCGGGAAGTGTGGCTGACGCTGCCAAGAAAC
AGCAGCGCGAGAAGGACGAAGCGGACGGTATTATTACGAAGGACAACACGACCACCACGGGTGCGGTTGTGGCTGCTACGTCGAAGAGCGTTGCTGGCGT
GACCGTCGCTGTGACAGGCATTGCCGCTATCGCCAGTACTGCTGTGGGAGGAGTCAGCTCTGCTGGTGCATCGCTTTCGGCCGCCGGATCTACCATGGCT
ATTACTACCATCGAGATTTGCCAGTTTGGCGTGCTCGTCAACCAGCTACAGCTGGACGGCAAGTCGTCGGCTCTGTCGCAGTTCGGCAAGTCCATGGCCC
CCGCGGCCTTCACGTTCCTGCCGTTCGGAAAGCTCAACAAAACTGAGTCGGGTAGCAGCAGCAGCAGTAGCACTTCCGGTCGTCGACTGGCAAGCTCCAC
CTCCGGCTCCAGCGGCAGCTCCAGCTCAAGCAGTTCGAGCCAGCTTACTGGTATTGCGAAGTACTCTCGCCAGCTGAACGTCAAGGAAGACATGCTGTTC
ATCGTGACACTGGCCGGTGTCTTCTGCGTGATGGCGTGCGTGGTGGGTCTGTTTGGTGTCGGCTACTTGATCGCTGGCCTGTTCATGCCTCGTGAGGAGT
ACCTGACCAAGTTCTTCGACAAGATGATCGGTTTGGAGGTTCTCGTGGCTATCCTGTCC