Description :
From Genome Similarity Track
Location :
scaffold_357:8225- 9249
Transcript NameFunction/comments
Pl_105683hypothetical protein PHYSODRAFT_333283

Sequence
1024 bases(100 bases per row)
AATTCTACGGCGGAAGAGCACATCAAGGAGGATGTAAATTACGGTCATGTTGGCGCCCGTGACGTTCGAGCCCGTGTATTACGGCGGAAAAGCACATCAA
GGAGGATAGTTTTGTAGTAAATTACGGTCATGGTGGCGCCCGTGACGTTCGAGCCCGTGTACACCAACGAGGCTCGACCATTGCTATTGCAGCAGAATGA
GACTCTCGTGGCCATTGCAGACTGTCACGAACTCAAACCTCATGAGCCAGAACCTAATACTGCTGAGGAACTGCAGACACTCTTGACACTGGTATATCCC
GTTGTAAGTGAAAAGCATAATGGAAGCATCACAATATTAGCACAGGGAGTACTAACTCGCTCGGGTAATGGACAGGTGGGGACGACGGCACTTGAATTTT
TGCCTGGACTCACGTGTATCGTCTTGGCGGGACACATGGACTCTCCAAATACGCAGGAGCAGCCACTCTCTCGACAATGGTAGGTTTCCATTGGCATCGA
AGTAGTATAAGAAGCTTGACGGATTATCTGTTTCTACGTTGCAGTTTATGAACGTGACGAATTATTCCGTGTGTTTCGGGCTCTCGTCGGCTCTGGACAC
GTTGTGCTCGCAAGCGTATGGTGCTCGGAGATATGATAAAATTGGTGTCTACTTCCAAGCTGGAGTGCTCGTACTGGCTGCAGTATTTGGTCCTATTTTC
CTGCTGAACTGGTACACGCAAGAGCTGATGGTGCTCGTAGGGCAAGATGAAGAGATATCGAGGCTGGCGCAGAACTTTTCTAGGTGGATGCTGCTGGGAA
TGCCGTTTGTGGTTCTCTATGAATTGGTGCGGAAGGTGTTGCAGGCGCAAAACATTATGAAGCCCCTTGTGGCCATTGCAACCATCGGTAATGTTGTGAA
CGTCGTGACAGGCTACCTGTTGGCTTATCACACGCCTATGGGATTCGAAGGCATTGCGTTATCGAGGTCTCTTGGAAATATCACTTTGCCAATACTCCTG
ATTCCGTACTTTTACTACTATCCG