Description :
From Genome Similarity Track
Location :
contig_75:82235- 83428
Transcript NameFunction/comments
g12335.t1hypothetical protein

Sequence
1193 bases(100 bases per row)
CGCGTGGGCGGCTTCCTCGGGGCATTCTTGCAGACTGAGTAATGGCGAAGTGCAGAGCTGATGAATGGCTAGCTCGCTGCGTAACCTATCGACTGGTGGT
AATTTATCTCCGGGGTGCCTTTTGATATGTCATGATAGATGATCAAAATGGAGTAATCTGATAGGTTGATATTTTTCAACCGTCGCCTGCAAGGGGTGCC
TTTTGATAAGAGTTTTGCGGTATTGGTGCGACTCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAGGTGTGATTCCTGCAT
CTAGGATGGCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCTTACCGTCTGC
CGACTTGGATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTCTAGGACTCGC
ATGATTGAAATCACTTCCTTCTCGGCGAGCTGGTATCTCAGCTCAGCGTCGTTCAGGACACGCCCCGTGAAGCGAACCGGATGAATGACTCCATCGTACT
CTTGGCCTAGTACCGCAGACGCTACCCACTGATTAGCATGCGGGATGATCACAAATGGTCGTGTGCGGTCAGGATGCCGCAGTAGTGGAGTCGATACAAT
CTTGCGCTTCAGGATCTCAAACGCTTCCTTGGCTCGCGACAAGTCTCGTCCAGCACGTATCTGTTCGTCCGTCAGCTCATATAGGACAGCGGCGATCACG
GGGAGGTCTTCGATAAACTTATTATAGTAATTCAGACTTCCCATGAAAGACTGCACTCCCTTGAGTGTCTTCGGGAACGGCAAATCCTGGACTCCCTTCG
CAATCTTTGGCTTCGCCCGGATACCTTCAGCACTAATTCATGCGAGAGTACGGAATGGACAACTTGCCAATCGCTCTTGGGTAGACTTTACAGAGATATT
CCAATAGCGTAACCGAAACAGTAAAGCGTTCAAGTCTTCACACAGGTGATCCCATGTTGGTGCACCATGAGCGATGTCGTCAATGTACGAGCTGCGCCCG
AGCACAGGGCCCATCTGAGGTGGGGCTGGGATGTTACGCTGGAAGACTGTCATCTTATCCGCCAAAATCGAGAAATCCCTCCTCAATACTATC