Description :
From Genome Similarity Track
Location :
contig_44:8223- 9674
Transcript NameFunction/comments
g7917.t1hypothetical protein

Sequence
1451 bases(100 bases per row)
CGCATGAAAGTGTCAAGAAGCACATCAAGGGCAAGTTGCTTCGATGGGCGATGAAATTGATGAACTTTCGGTACATTGTGGAACATGTACCTGGTCCTGA
TAACGTATGGGCCGATATGATCTCGCGCTGGGCGGGCAACACGCTCCCGTGCAACGGTGAAGCGGATCAAGGCGGTGCGCCAACGAACGCCACCGACCCG
AGCTAGACTACGACCTCTCGACGAGGATCAATTTGTGTGGCCTACGCTCGACGAGTTAATTGGGATCCAAACCCAGTATAAACCACCAGCGAGAGCAAAC
TACCGAGGATGGAACGATCACAGTGGAGGGCAGAATTTGGGTGCCATCGGAAGCAACTGAGCTGATCCAGCGGCTGTGCGTCGTTGCACACTGCGGGGCC
CAAGGTCATCGCGGCCAACAGGCCATGATCGCTCACCTTCGACGCCTCTTTGTGATCGAACATCTTGCGGACATTGTGGCGAAATTTGTGAACGATTGCT
TGATGTGCCTGCATAGTCGAGGGGGGAGGATTATCCCCAGGCCTTGGGGCGAACTGATCGATTGCAGCACACGCAATGGCGTTCTACATTTTGATTTTCT
CTACATGGGGGCAAGCTATGGGGCCAGCAAGTATCTACTAGTCCTGAAAGACCACGCTACGCACTACTGTGAATTGGTGGTGGCAGATACGGCCGATAGC
AGAGTCACGACCGAAGCACTTCTAGCATGGCATTCACGATTTGGTGTGCCACCTATCTGGGTTCGGACAATGGCTCGCATTTTAAAAACGAGGTCGTCGC
CGACCTGAGCCGACTACGTACACAGCAGACATTTACGCCAGCTTACTGTCCATGGGTCAATGGGTCAGTCGAACGTGTCAATCGTGACATTCTCCAAGTC
ATCAGGGCGATGATTTTAGCCTACAAGGTGAGCTACAAAGATTGGGTGTACTTGGTCCCAATGGTGCAGGCGAGTTTGAATCATACTGCTGTGCCATCTC
TGGGGAACCATTCACCGACAGAGCTATTCACTGGGCTACAAATCCGACTCCGCTCCGCGAATTTTATTTACCTGACTCCAAAGAGCTGCAGGAGATTCCG
GAGTCTGAAGAGATCGAGGGCTACCTAGCAAAACTACGTGAAAGTGTTCAAGCCATGCACTGCGCAGTTGAAGACCAGAGGCTCAAGCAGCGCCTCCTCA
ACAAGAAGCGTGAGCGGGTGAGAATTTGGTGAACTTCACGGTGGGCGATTTTGTACTCCGCTCTCGAGTGGATGAGAAGCAGGGTAACAAATTGCAGGTA
ACCTGGGTGGGACCGTATCGTGTGGTACGAGCGGACACTCATTCATTTCGAGTGCAGCATTTGGTGACCGGCGACGAGCTGGACGTGCATGCGTCGAGAT
TGAAGATGTACGCCGATGAGGACTAGAGGTGACAGACGAGCTGTTGGAGCA