Description :
From Genome Similarity Track
Location :
Scaffold_17:82202- 83697
Transcript NameFunction/comments
Physo_370736vacuolar protein sorting-associated protein, putative

Sequence
1495 bases(100 bases per row)
TGCGCGAGCGAGTCGGTGAGCGTTTGCCTCGCTTCACGACCGAGCAGACCGCTCTAGTCAAGGTCTCGTACGACGTGCTGATGTTAAACCACTATTTCGC
TCGCACCTATTTTCACGGAACATGGCTGCAATCTGATTACGCGGATCCTGTACACTACCATCGGGCCACAGCGGCCCTTGCCGCCGCTATCGATGCCGCC
CGCAGCCATGGCCAAGGCCATCATCTCGTCGATCCTGGAGGCGCAGCTGGGCAAGTATGTGGCCGGCCTGCGCAGCGACTCGCTGGTCGTGGGGCTGTGG
AGTGGCGAGCTGGAGCTGCGCGACCTGTCACTAAAGCCGCATTCGCTGGCCGAGCTGCAGCTGCCCGTAGCCGTGACCAGCGGCAGCGTGGGCCGCGTGC
TGGTGCGCCTGCCCTGGAACCAGTTGGGCAGCGCGAGCATGGCCATCACTCTCGAGGGCGTGTTGGCGCTCGTGGTGCCCAACACGGAGCCGCGCAGCGC
GGCCGAGAAGAATCAGCTGGAGCTGCTGCGCCAGCACCGCCGCTTCGCCGCGCGCGTTGGCCCAGGTCAGGAGCAGCACGAGCAGCAGAAGCCCGAGGAG
GACGAGGGCACCTTCGTCTCGAGACTCACGGCCCGCATCGTGGCCAACCTGCAGGTGACGCTGCGGGACGTGCATCTGATCCCCCACGCCCACATCACCG
CCAAATGCGCTGGTCGTCAGTACAGAAGGCGCTGCTGGAGCAAAAATTGTACGTCGAGGCTTTCAGGACGGAGCTGCGCAACGATTCACCATTGGACCCC
TCGACGAGGCAGGGCAAGTTCAAGCAGCGATATGAAGAAATCTACCCGCTGGATGTGGTGCTGCTGTTACGCGACGTTGCCGAAGCCGCCGAGAAGCGTG
CGAAGGAGGAAGTGGAAGCTTCGGCCAAAGAACACGCTAAAACACAGGCGACTCAAGGCGGAGGTGGCTCGTGGTACTCGTATTTCGTCGTCGGCGAAAG
TGAATCTGCTCCCGCGTCAAGTGAAGCAGCGGAGGAGCACGTATTGTCTGCCGAGGGCTGGGAAAATCTACGCGAGGCTTACAATAACGCTGTGGAGAAG
GCTAGCAACGCACACGAAGTGCCGATGGGGTGCAACCCGGTGTCCGTGCAGTTTCAGCTGACAAATGGCTGTTTCAATCCAATACACACGAGAGTTTGTT
CGTGACTGTAATGTTCAATGGCTCGCTGGCTGTGAACATTCAGCCGGAAAACGAGCTTCCAAGTGCAGCACTTCGACATCTTTAACGGGCTCGCACACGA
TTTTCGGTTCCATTCGTTCTGTAGCCCGGCATCGTCGCTATCGCCGTGTGAAGGCCCGGGTACGTGCTGCGTCAGTATCGACGTGAGTCGTCGGGCGGTG
CTACAGACCCAACGGCAGGGTGACGATGACGTGGAAGCCACGCTGAAGGTCCGCGTCCGCAGGGAGCCTGTCCGGATGACGGTTGATAAAGGTTA