Description :
From Genome Similarity Track
Location :
scaffold_9:82201- 83789
Transcript NameFunction/comments
g4495.t1 hypothetical protein PHYSODRAFT_506679

Sequence
1588 bases(100 bases per row)
CTCAGTCGCCGCAGGAGTATGACGGCGGTGCTCTTCGGGAGGGAGGGGAGGTGAACATTTGGAGTCGTGAATACATCGGATTGGTCGCGCAGTACGCCGC
GGTGGGTATGATCTTCGGAACTCTGCCCGGCACAGTCTACCCGTTCCTCTTCAACTACCTCAACATGGAAGGCACGCAAGTCGTGTCGGCTGTGGTTCTG
CTCAACATGCCGTGGTCGTTCAAGATTTTTTACGGCATGATCACGGACTGCGTCCCTATTTGGGGGTATCGACGCCGTCCGTTCATGGTCATCGGATGGA
CCCTTTGTTTCGCGATGCTGCTTGTCATGGCCTGCATGGATGCCGGCGCTCCATACTTTCCGGACAACAAGTACGCGACGATGGATGAATCGGAGCTGAC
CCCTGAACTCGTTGCGACTTTCAACGACTCGGCACACCACGTGGGCGGCAAGTTTATCGTGCTTATGATGATCGCCGCCATCGGCTACGTCGGAGCCGAT
GTCGCTGCTGATGCCATGATGGTGGAAGTAGCTCAACGTGAACCGGAGTCTACGCGCGGATACACACAAACCACGATCTACATGATCCGCACGGCGTTTG
TGACCGTTTCCAGTATCCTCACTGGTTTGGCTTTCAATGGCAAAGACTACGGGGGTGACTTTGACTTCTCGCTGAGTTTTCCTCAGCTTATGGTTATTCT
CACTATCTGTTGTCTTCCAGTGATCCCTCTCTCGTGGTACTGCATCAAAGAGGAGCGCCATCCTGGCGTGATTTTCCGTGATTACATGGCTGAACTCTGG
CACCTCATCCAAACGCGCCCGGTGTACCAAGTCATCGCGTACAAATACTTGTCGGGCATTTTCGAGAACTTCACCATCACTTGTGCTGACCCCATGCAGT
CGTACTGGGCTGGGGCCACCCCACTCAATCAAAAGGTGATGGCCATCATCGGCAACGGCATCTTCGCCCTCACGCTTTACTTAACTGGTAGATATGGTCT
CCACTGGAACTGGCGATCAATGCACGCCATCACGATCGTCTCAGTCACCATCATGGACTTCATTGTAACGATGCTCACGACGTGGGACGTCCTACGCAAC
CAGTGGTTTTGGCTCGGAGTGCCCGTGGTGGAGAACCTTCCGAATGGCATCTCTTTCGTGATCGGAACGTACGTGATCGTGGAGCTGGCCGGTGAGGGTA
ACGAAGGTGCTGTGTACGGACTGGTGGGATCGATCTCCAACATCGCTATTCCCCTGGCCAGCACGCTGTCGAAGAACGTGGACAGCTACTTTGACGTGAC
CAACGCCGATATTGTCGAGGATTCGACCCATGTGCGCTGGGATGTGACGTACGTCCTCATCATCCGGTACGCTATGAACCTCGCGGGACTTGTCTTCCTG
CCGCTCCTCCCGCGCCAGAAGGCTGAGACGCAGCAGCTCAAGCAAAACGGTGGCTTCAGTCGCTTCATGGGAATCCTGACCTCCATCTACTTCGCGTTTT
CACTCTGCTGGACGGTCATGGTGAACATCATGTCCATCTACCCATCCACTTCATGCCTAGTAATTGCTGGTGGCACCGGCTGTGACTC