Description :
From Genome Similarity Track
Location :
Scaffold_2264:822- 2557
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2264-snap-gene-0.1B-box zinc finger family protein

Sequence
1735 bases(100 bases per row)
TCGGTCGGTAAGGTTGCTTTCATGTTGAGCAGTTTCTTTCGAATGTCGGTATTGTCTGACGAATGTCGCTGAGAGCCACCGTATTGACTGATCGAGTCGT
GCGGGCGTCGACTGAACCGTGCCGAAGACTGGCGGCTACTGCTGTCATCGCTGTCACCATGGACCACAAGGTTCAATTGCTCTCCGCTGACAACCTGCAG
TCTTCCAACCAGCTCTAGATCGCCTTTCACCTGCTCTGCGCTCGATCCATGTGCAAATGCTGGGAAGTCACGCTGCTCCGAACGCACAAGTTTATGCTGG
TTCCAGACACCTAGGAATTCCACCACTGGGGAACATGCCCGCAAGTCGTCCAGTGTGTCCTCGGCCCATTCGATTTGCTGGAGCTGCCGCTGATACTCGA
GTGCTTCGCCGTCGAGCACGACCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCATCCTCGAGGCGGCTCAGCGCCTGCTCGCATTGCAAACG
AATAGCTGCCTCGACTTGCTCTTTGTTGTGCAGCACATCTTCTTTCGATTTCGCGAGCGAGTGCAGTTTGTTCTCGATCACCAATTTCCGCGACTCCACT
AGAGGATCGTTCTTCAGCGACTCGCGAAGACTCAACTCGTACGCGTCGGTGATCGTGAGCAGCCGATGGCTTCCTTTCTCTCCGATCGAATGATCGCCCA
CCATTTTGCAATGCACACACACTGGGAGCTCGCAGACTGAGCAGTAGAATTCGACATGCTTGCCCTCGTGGAAACGACAGCCTGTCTGAGTATCTGCCAA
ACCGTCTTCCAATTGCTTCGCTACGATCGCGTTCACGTCTGTGTCCTGCTGTTGTTCAAGGTTTGATGCCGACGGTGATGATGGTGACAAAGGTGATGCC
AGTGCTGCATCTGACGATAATGCGGATGAACTGCGACGACGAGAGCGACTCGCAGGCGTTCCTGTACCTCTGGTGTGTTTTGCTTTCCGGTGCAATGGCA
CACGCTTATGGCGGCTCACCAACTTGTTTGCTGAATGCACTTCTTGGTCACACGTCAGGCAAATCGATGCCTCACAAGCCCGACAAACAACGGCTGCCGA
GTGTTTTTCGCACAACGCGCACGGACCCGCGCTCTTGGAATCCATTGCACTGTAGTGAAAGCGAACCAAGTGCTGCGGCAGGATCTGAAACGCATTGTTG
AGGATGTATTCGTGGTAGTATCCACGATCGACGTCATCGTCTTGTGCGTTGTGCTGCAGGTAAAAGCTGTGGTAGCCGCCTGGTAGTCGCTTCTTGGCTT
CTTCTTCGTTTTGAATGGCCAGCGATTTCCCGACAGCAATTTTGCAGAGCACAAGCTGTTGAGTTCCTTTGCTCTTTAGCGGTGGCCCAAGCTGCAAGTT
GCCGGTCGTAAACTTCATTCCTGTTTGGCTTGCGTCGAGTGAGGTGAATCCATAACTGTGCACATCGCCCATCGCCGCTCCGAGGTCGTTCACAGCGACC
CACGAGTCCAACTCGAGGAGTCCATGGGAATGCTGCTCGTACTGCGCCACAAGCGACGGGTTGGTCATATCCCACATCATGATGTCGTCGTGCACCTTGT
ACCCAGGTAGACAGCACTGCAGCAGATACTTGACTCGCGCGAAATCCTTCGTAGTATGGCTCAGCGGACTCACACTTGCGACTGCTCCAGCAACCGGTAT
CGTCACTTCGCTTGCCTCTGCATCTTCATCTTCGG