Description :
From Genome Similarity Track
Location :
Scaffold_33:8218- 11049
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_33-fgenesh-gene-0.16Lysosomal alpha-mannosidase

Sequence
2831 bases(100 bases per row)
CGTGCCAACGAGGTTGAGCTCAGTCACCTCTGAAAGCTGCGCGTTCTTCACATGGAAGTACTTGGCGAAGTCGAAGTTGATATCCTTGGACAGTGATGAG
TGCTCATCCACCGCGTATAGGTGGGTAAGGCGCACCAACAGCGAGTtCTTTGACAGTTCCATGAGCGACGTCAAACCAACGTTCTCAGGGAAGTCACTAA
GAGTGAGCCATGGAACCTTTGCTTCAATCTCCGAGGAAGTTGCCTTGCGGAAGAGGGTCAATGGCTGGAAGAAAGCCGATTCCATCTTGCGACGAATAGA
ACGGATGCCGTCATCACCAGCCTTGTCAACGTTAATAAAGAGGTTGCCACGGGCAACGAGGCCCTTCGTGATCGTCTTCTTGAGAATTGGATCGACGAAG
GATTCGGTCTCGTTCAGGTTCtCGTTCACACCCTTCTGATCGTCCCTCAGCAAACGACGGTGAACCATAACTTCCATCTGGCCATCTTCCAGGCTAGCAA
GTCCTTGAGCACGATCAGTGGCGATGTTGAGCTGGAACTTGTCGTCCTTCAGGTATGCACCAGTCGTGATTGGGAAATAGTTGGCTGCCACAAACTCCTG
GTCATCGCGAAGCTTCAAGTCCCAAGTGTCACGGTGGTTACGAACACGCGTCACAAACTCAAGGCCGTTCGAATCAGTGTACCACGTTCCCTTGGACTGG
ATTGCTTTCTTCGTGTCGAAACGAAGAATTACTTCCTTACCCTTGGAGTCTTCGACAGGAATGGGGCCGACCGTCCATTCAATCTCGACAAAGGTATCGC
CTGGGTTGAGTACGTATTCAAGGGTAACCCAGCCTCCAATCTTAAAGGCAATTCGGGAAGCGGCCTCATTGGATCCGAGGGCGATGTTGAGCATAGTGAC
CTTAGCTTCATCGTCACTTACGAGAGAGTACACAGTCTTGGAGTCGGGACGGAACAAGTAAGCACCAGAATGGCGGCCGTTCTTACCTTGATACGCAAGG
TAGTATCCAACATCCAGGGAAAGTGGCAACGTGACCTTGCTTTCCTTGTTAGTCACAGATACAATCATTCCCGACTTCGTGTCAATCGTGGCTGCGACGA
CATCGTTCTCCAAGACGACGGTAGAACCcAAAAaGTCGTCAGACACGTCATCAATGCGGCgATCAATTGTCTCTTCCTTCATCGgACTCTCAAATtGCTG
AaGCAGGAaTCGCTGCGAGCTCAATGGCCCCAaTCAGCTGTGAaGGAAaCCTTGTATGgTAACgCCTTTtGAGtCtCGGGGTGAACTGGAAGGGCCTtGt
ACACAaCAACATCaGATGGGTCAGGGCCCCcGCCCAATGCcGTCACCTTCGCAGCCTTTCGGTCGATCGGAACAGTGATGGTCTGCTTGGCCTTTCGGGG
CAATGGGTTGTGGACATAAACTTCAACCTTCTCCGTGTTTCGTGTCACTTCACAAATGCTCACATTGCTCAGGAGACACAGTTGGAACTTCTCCTTCTCC
CCGATGACGAACAGAACCTCATTCAATTCCTTCTCAGCTTCAATGATGCCTTCATTGATGCGCAGCGAGTAGTCATCGGAaaCAACTTGCTTCTCCGTGC
CAGAGATACCGTCGTGGTGTTGGGTGACCCCTACACCGCGCTGAAGCTTCTCAAGCGCAGCCGAGTGGTGGCTTTGGTAGATCGCATCCAACTGACGGGC
CTGCTGCAAAACAAGGTTGCCCACACGGGCAAATCGCTTCAATGTTGGTCGACTGGTGAAGTATCCAGTCCAGTATTCGTGATCCTGAGAGGCGTACGGG
AAGAAGTCATCGGtcTTCAGCTGCCAAGTGATGTTTTCTGCAAGCTTGAGATCCGTGTAGTACGAAAGGTTCGAATAGAGCACATTGACGCGACCATCCT
GGTTAACGTAGTGGATAAGCTTGTCCAAGCTCTTGTACCACTTGCGCGCGTTCTGGTACGAGAAATCATCGCCCATTGGCAAGAAGATGTGGTTTCCCTT
GCTGTGCTTCCTACGCTCAATCGTGTTGCTCACGAACCAGTTCACCTGGTCGCAAACGTTGAAGTCGTGCATGTCAGGATCGTCCTGGATTGGCTGATCA
TTCTCGTAGTGGAAGTGACCAGGGGCGCCGTAGTGGTCGATGATATTGCCGGTGAAGGTCTGCATCGCCTTACCTCGCGACTTGCTCGGACGCCACATGA
ACTCGAGGTCTTTGTTATCGTAACGCTTCCCGTAGTCCTGGTAGTCGATGCGCGCGAAATAGAGTGCATCAAAaCCCAAGCCAGCCGAAAGAAGCGAACC
CTGAGTGGACGAGTGCCCAAATGGGTCGATTTGCCAACCAATTCGCGGTGTGATGCCGAATTCTTGCTTCAGAAGCTGATGACCGTAGGCAGTTTGGTCA
ATCATGGCGATATAGTGTGgCGCAGCTTCGTCATGCATGCACCAACCGCCGTTGACGCTCAGATCGAGACGGCCTTCCTTCACGAGCTGCTTgACGATGT
GCTTCGTCTTCTCGCTCTGCTCCTTCCACCAGCGCTGGAAGAAGGACTGCTCCACGAACATGAACTTACGGtCCGGGTTCTCCAGCAGTTCTTGAACGGC
CGTGTCAAGGATAAACTGCACACGCTCGTAGTAATACTGGTCCACGGTGaTAATCCAACCCCTGTTATCATCCTCACATTAGTGCATCAAGCCAAACGCA
GCCATCGCATGCTACACATACGGATCGTCGTGCGAGTGTGGGATCAAGTGAACATTGAGCTTGTCATCTGCAATGCGGCCGGCGGTGTTGTACTTGCCGT
CAACTGGCAGCTTCCATTTGCTCGGGTCACA