Description :
From Genome Similarity Track
Location :
Scaffold_99:82176- 84367
Transcript NameFunction/comments
Phyra_83913myosin-like protein

Sequence
2191 bases(100 bases per row)
CAGGCAGCGGGCGAACGCAACTACCACATCTTCTACCAACTTGTGAGCGCCAAGGAGGATATCTTTGGCTTCAGTGATGACTCGTCCGCGAGCGAGTTCA
GGTACCTGCAGGACGAGAAACTCATTCTGGACGGCCAGACGGACCTTGAACGGTACCAGGTCACTCGTGATGCGCTGAGTACCATTGGGCTCAGCGACGA
GGAGCAGAACCAGCTCTTCAGTGCTCTCTGCGGTATCTTGCGTCTGGGCCAGCTCGACTTTGTTCCTTTGGAGTCAAACAAGGACGATGCCAGCCAGGCG
GTTGCTTCGTTGAATGCGTCAGCGACTTCTGCCCCTGTCACTGCGGAGCAGATTGAACAGCAGAAGATGGAAATCGAGCAGTGCGCGAAGCTGCTGGGTG
TGGAAGTGACCGCGTTGAGCAAGCAGCTCTGCAGCCGTACCGTCAAGGCGCGCCAGGAGGTGTACTGCGTCCCGCTGTCAGCTCTGCATGCCGGCAACAA
TCGTGACGCTTTAGCGAAGGAGATCTATGCGCGAGTATTTGGCTACTTGGTGCGACGCGTGAACCACAGTATCTCGAACTCGGCGGACAGAGGCGCTTCG
ACGCCGTCATACTTGCATATCGACCTGCTGGATATCTTCGGCTTCGAGTCGTTCGAACACAACAGCTTCGAGCAGTTCTGCATTAACTTTGCGAACGAAA
AACTGCAGCAGAAGTTCACGATGGATGTGTTTAAGACGGTTCAGGAGGAGTACCAGCAAGAGGGCGTTGCCTGGGAATTCGTGAAGTACCGCGACAACCA
AGACATGTTGGATCTACTGGAGAACTCGATGGGCGTGATGGCACTGCTGAACGAAGAATGTGTGCGCCCCATGGGAAGTGATTTGTCATTTGTATCGAAG
CTTGTGTCACTGCGCGAGTCACATCCACGTCTTGAGCGAGCACGCCTCAGTCAGACGCACTTCATGCTGCACCACTATGCGGGCCCCGTGACATACGACG
CGGAAGGCTTTGTCGAGAAGAACAAGGACTCGTTGCAGACTGATCTACTGGAGCTGCTTGGTACGAGCTCAAATGGCTTGCTGTCGATGGTATTCGGCGA
CGACAACAACACAGCATTCATGACAGACGCGGATCTGGCTGTCCGTGCGGCAACCATGATGGAGTCGGGACGACGCAGTACTGTCGGACGGAAAACGTCA
ACCTTCATGCAAGAGACCGTGAGCTACAAATTCAAAGCACAGTTGTCGCTGTTGATGAGTGACATTTCCAGCACTGAGGTGCACTATGTACGTTGCATTA
AACCCAACTCGCAAAAGAGCCCGAGTGTCTACGAGATCGATGCGGTTGTGAACCAGCTTCGCTGCGCCGGTGTCGTTGAGGCCATCCGTATCACACGCGC
CGCATTCCCCAACAAGATGGCTCACGAAAAGTTCTTGCGCCGATTTGTGATGATGCGAAGCAAGAAGGGTGCTACTATCGCTGCAGCATCCACAACTGTC
ACTGAGGCTTGCGAACAGCTTGCGAAGGAACTACTTAGTGGAGATGACTTTGCCCGAACGCAAGACGGCAGTGAACACTCCAGGACACCAACGTTCGTGG
TAGGTAAGAGCCTGGTCTACTTCGGCAAGGACGTGCTTGAGTTCCTGGAGCACAGGCGCACCACTTTCGTGCATGACCAAGCAATTGTGATCCAGCAGAC
TGCGCGCCGGTGGATGGCGAGACGAAAGATTAAGAAGGTCCGCACAATGATCGCAAAAGTTCAGGCCCTTCAACGCTGCCGGATACAGCGCCGATCATAC
TTGGAGAAGCGCAGGAAGTGCACCATTGTGCAAAGTGTGTGGCGTGGAGTGCGCTCGCGTCAGCGTGTGTATTTGATGATGAAGGAGAAGAGCGCGATCA
AGGTCCAAACTGCGTACCGTCAGTATCTCGCGGAAAAGAAGTATGCAAAGTTCCGGAATGCTGTCATCAAAATGCAAAGCACTCTTAAGATGAAGAAGCA
AGTGGGCAAGTACCACAAACTTCTGTCTGAACGAAAAGAGCAGGATGCAATGGAGACCGAGGTAGAGCTTCTCAAGCACCGTCTTGAGGACGAGAAACGC
GCGCGCATGGAGATCGAAGCGGAGAACTCGTCGCTGCAGCAAGAGCTAAACCAGGTTCGGAATTCCTCTGTGCCTAGTGCGGACAGCAGCA