Description :
From Genome Similarity Track
Location :
Scaffold_225:82162- 84843
Sequence
2681 bases(100 bases per row)
AATATTATTTTCTTAAAAATCAAAAAACGATAAACTTATTAATATATTAATATTTTCGATAAAATTAATATTTGATAAAATTAAAAAAATATGATTAAAA
TTTAATGAACCTGTAAGAGCATAAATTATAGTGGGGCCTACACATCTCCGACCGGATAGCCACTACTAACTGAAATCTCTGGGGGCCAGCCAGTCCAGGG
CCCCCGACTATTCGATGTCGAGGGTTTATTCGTCTTCAAGAGGCCGAGCTCAGTGGTACCGGGGTTCCCGGATGGTACAACTAAGACTTGTGTGTCACAC
ATTTTTAACGACCTTGGGTTGGTCGCAAGGGGGATCAAACCGGCAATCATTGGATTGGAATGGCGGTGCTTACCCAAGGCACCAGGGGGGAGCCCTCTCG
ACGAGTGTCTAATGGTCATCTATTGATCGTGGCACGTGGTCCCGTTCATCATTGTAGCTGCTGCTACTGGCAGTTATGGCGCAGATGATTTCAGAGGCTT
GTTTTCTACGCGAAGTAACGCTATCGGTAGATAGATACATGGATGGTCCATCCACTGCGTTCGGGCGTAAATGGGTGAGCATTCAACCCCAGTCACTAGC
GTCGGCGGATGCGTGGTCAATTTTTTGTGCATCCAGTTTGACAGAGAAGTTTCTAGCGGTCGAATCGCTGGCGCAAGGGTTTCACGTCCTACAATACCGA
TGCGACTTCCTTAGCGAAGCCCTAAATTGAAATGAGTGGATGTTGCCCCGATGACAATCTGATTGCAAACGTATGCAGACGAGCGTCACTGTGAGCACTT
AGCACAGCAATGGCACTTTTACAGATATGACCATTTTGTGATGTCTTATCACATGACGGGCGTAAATGCGCTCCAAGCGCGGAGCGAGCATTCAGAACTC
GCACGGGCTGCGGGAAATGAGACGCGGCGTGGATCGAGCCCGAAATTTGCTTTTCAGCTCACTCAGCCTTGCTCGCAGTCGAACTCTTTAATTCGTCCGC
ATCCAAAGTTATTCGAAATTTTCATTCTAACCTTGGACGGCTTAGCTGCTACTGAGCGCAGGGCACTCCTTCTTTTTTGGCGCGAATTATGTTGCATTCA
GCTGGGATCAGGTGCGGGACCAAAGTAATCGAGACAAATTAATCGGTGCATGTGCACATTGGTTAAGTGCATAAAGCCTTAAGATCTCCAATGTCAACAC
ACAGCCCGCTAAATTAATTGATCGAACGCTTTCTTAAAATGCAACACGTCATATTACTTGATCGAACGCTTTTTGAGCAAAGTTATTGCTTCCACATTTA
CATGTAGCGAAACGTTTTTTCAGCCACCATCCTGTCATTAATCATCCACCACCAACTAATAATTAATATGGTTCTATATTATTTGGAAAACAGTTCATTT
AAGAGGTCACACAAATATACATTATAAAAGCCATTGGACAGATCTTTCGCAATCCATTGAGTTAGATGCTATTAGTTCAGGCGTAAGACGTGCGACAGAG
TCACACGTCTTACTAAATCTAATATCACGGAAAGCGAGATTGTCTCGCTGATCGGGCATATAAACCAAATACAGATAGGCCGAATGTATTAGATTTATGG
GCCGCCGCTATCTACAAAGGTAGACAAGTAGTCCTTACATGCGATCAAGGGCATCGTGCTGGGGTGTGCTATTTAATGTCAAGGACTCGTCATCACAAGT
TGGAAAATGAAGGTTGAAGTATCAGAAGTTTGTTCGATAAACTTATTATTTGTGATTGGCGCGACACTAGACGAAGAGGCCAAAGCTACCCTGGCCCTGA
ACAAGCACCCCGTACTACGGCTGAAACACGTTCGCAAATCATTTTTATATCTCTGGGGGTTAGACTAGGAGCGGGATATAAATAAATATTCACTGCGTCC
TCATTTTTAATTGCTTACCCTTTTTTGCGTTTGGCAACAACGACACATCATTTTTGCTGCACCTGAGCTTCACTTGCTCTCTTCGCCTCTTTCAAAGAAT
CGTACACAATCTGGACCGTGACAAAAGACTCTCAATAGATCTTAGCAATGGATTGACAAACCTGGAATTAATTATTGTTAGCAGCACAAAAATGGACAGA
GGTTTAATAATAAAAATGTTTGAGCCTGAAAAACACTGGGAAGCTTCAAATATACCTAGGCGCAGTGTTCGAAATACCCTAGGTTCATATCACGATATCC
ATTGTCGTATATTTTCTATACCAGCAAATATTAACGAGACAGTCCTGACTTTGCTTTTTTTATTTCTTTATCCTCTTCATTACGATGCGTCTTCCAGCCT
TCCCCTCAGGTGGTACCGCTCACGATACTGAGCCTTTGCTGCTTCAGAGTCGGTCTCAGCTACTAATAAAGCTAAATTTTGGAAGCTACCTCGTAAACAT
ATATATGAAGGAAGACCTTGACGCTCTCAGACCCTTTACGAAATCACTAGCTTTATTACCAGATTTTTACTGATTTCTTGCTTTCTTATATGCTCATTTG
GGCCTCAGCGGTCTTCATCAGTTTGTCATCAGCGCCTGCAAGCAGTGTCTCCGCTAGCAACTACTAATGTTCACGCGCGTGTAGTTGAACAGATCTCTAT
CACCATCGCAAGCAAAAACAAATTTTGGCGTGGGGCACGCTTCCTCACATGTACTCGGACAGCGCTGGTTGCATTCGAGCG