Description :
From Genome Similarity Track
Location :
contig_44:8215- 9218
Transcript NameFunction/comments
g9749.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CCACAGGAATCTCATTCACGTTTTCTCACCGCATGAAAGTGTCAAGAAGCACATCAAGGGCAAGTTGCTTCGATGGGCGATGAAATTGATGAACTTTCGG
TACATTGTGGAACATGTACCTGGTCCTGATAACGTATGGGCCGATATGATCTCGCGCTGGGCGGGCAACCACGCTCCCGTGCCAGCGGTGAAGCGGATCA
AGGCGGTGCGCCAACGAACGCCACCGACCCGAGCTAGACTACGACCTCTCGACGAGGATCAATTTGTGTGGCCTACGCTCGACGAGTTAATTGGGATCCA
AACCCAGTATAAACCACCAGCGAGAGCAAACTACCGAGGATGGAACGATCACAGTGGAGGGCAGAATTTGGGTGCCATCGGAAGCAACTGAGCTGATCCA
GCGGCTGTGCGTCGTTGCACACTGCGGGGCCCAAGGTCATCGCGGCCAACAGGCCATGATCGCTCACCTTCGACGCCTCTTTGTGATCGAACATCTTGCG
GACATTGTGGCGAAATTTGTGAACGATTGCTTGATGTGCCTGCATAGTCGAGGGGGGAGGATTATCCCCAGGCCTTGGGGCGAACTGATCGATTGCAGCA
CACGCAATGGCGTTCTACATTTTGATTTTCTCTACATGGGGGCAAGCTATGGGGCCAGCAAGTATCTACTAGTCCTGAAAGACCACGCTGCGCACTACTG
TGAATTGGTGGTGGCAGATACGGCCGATAGCAGAGTCACGACCGAAGCACTTCTAGCATGGCATTCACGATTTGGTGTGCCACCTATCTGGGTTTCGGAC
AATGGCTCGCATTTTAAAAACGAGGTCGTCGCCGACCTGAGCCGACTACGTACACAGCAGACATTTACGCCTGCTTACTGTCCATGGGTCAATGGGTCAG
TCGAACGTGTCAATCGTGACATTCTCCAAGTCATCAGGGCGATGATTTTAGCCTACAAGGTGAGTTACAAAGATTGGGTGTACTTGGTCCCAATGGTGCA
GGC