Description :
From Genome Similarity Track
Location :
contig_39:82147- 83377
Transcript NameFunction/comments
g6904.t1hypothetical protein

Sequence
1230 bases(100 bases per row)
ATGGCCCCCCAACACCAGAACGACTCAACCAAGACGGTCGCGACTACCAACGCGACAAGCCCGTGGCCGTCAAGAACGCGCTGAACCAGGAGGTGGCGCA
CTCCAAGTTCGAGCACCCGGAGCTGCTCAGCGTGTACCCCGACACCAAGTTCGACCCGATCCCCGAGCTGTCCGTGGAGGACCGTGGCTCAAGGCCGACC
CGACGTTCAAGAACCTGCTCAAGGACGCTACAGTGACCCACCTGACGCCCAAGATCGGCACGGAGTTGAGTGGCATTCAGCTGCACGAGCTCAGCAACGA
ACAGCGCGATGAACTTGCGCTGCTCATCGCTCATCGCGGCGTCGTGTTCTTCCGCGACCAGGAGATCGACGTCGAGCAGCAGCTGGACCTGGGTCGCTAC
TACGGCCCTCTCCACGTGCACCAGAACCTGGGCCACCCGAAGGACCACCACGAGGTGCTGGTCGTAGAGAACTCGGTCGAGACGAGCGCGGGATTCCTCA
AGCGCCAAATGTACGACCCGTTCAACGCGTGGCACAGCGACGTGTCCAATGAGCGTCAACCGCCTTCGTACACGAGCTTCAAGGTGCTGACCAACCCTCC
GGTCGGCGGTGACACGCTTTGGGCATCGGGTTACGAGGCGTACGAGCGTCTCACCCCGCCGATGCGCGAGTTCATCTCGGGCCTCACCGCGATTCACACT
GGCAAGGTAAAGCACAACGTCTCTGGTCTAGTGTCTTTTAGATAGCTAATCGGTTGTTTCTTTGCTGGTTGGTAGCCGCAAGCTGCTGCTGCCGCTGCTA
AGGGACAAACCATTCGTCGTCCGCCGGTGGAGTTCGAGCACCCGGTGGTGCGCACCCACCCCGTGACCGGCCGTAGGGCTCTCTACGTGAACCCCGCCTT
CACCACGCGCATTGTGCAGCTCTCGACTGCGGAGTCCGGTACGCTGCAGCTGAATGTTGTGCGTGTGAGTGGTGTTTGCAGCTTGCTAACCGTCGTGGTT
GTCTATTTCGTTTGCAGACGCCGTGCTGAAGCTGCTGTACCAGCACGTCACCGAGGGCCACGAGTTCCAAGTGCGCTTCCGCTGGACCAAGAACGCGGTG
GCCATTTGGGACAACCGCGCGACGTTCCACTACGCAACGTTCGACTACCTGCCGGGCAACCGCCACGCTGTCCGCGTGACGCCACACGGCGAGGTGCCGT
ACTTTGACCCCAAGGCGGAGCCCAAGTAAG