Description :
From Genome Similarity Track
Location :
contig_44:8214- 9215
Transcript NameFunction/comments
g7917.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
GTTTCTCACCGCATGAAAGTGTCAAGAAGCACATCAAGGGCAAGTTGCTTCGATGGGCGATGAAATTGATGAACTTTCGGTACATTGTGGAACATGTACC
TGGTCCTGATAACGTATGGGCCGATATGATCTCGCGCTGGGCGGGCAACACGCTCCCGTGCAACGGTGAAGCGGATCAAGGCGGTGCGCCAACGAACGCC
ACCGACCCGAGCTAGACTACGACCTCTCGACGAGGATCAATTTGTGTGGCCTACGCTCGACGAGTTAATTGGGATCCAAACCCAGTATAAACCACCAGCG
AGAGCAAACTACCGAGGATGGAACGATCACAGTGGAGGGCAGAATTTGGGTGCCATCGGAAGCAACTGAGCTGATCCAGCGGCTGTGCGTCGTTGCACAC
TGCGGGGCCCAAGGTCATCGCGGCCAACAGGCCATGATCGCTCACCTTCGACGCCTCTTTGTGATCGAACATCTTGCGGACATTGTGGCGAAATTTGTGA
ACGATTGCTTGATGTGCCTGCATAGTCGAGGGGGGAGGATTATCCCCAGGCCTTGGGGCGAACTGATCGATTGCAGCACACGCAATGGCGTTCTACATTT
TGATTTTCTCTACATGGGGGCAAGCTATGGGGCCAGCAAGTATCTACTAGTCCTGAAAGACCACGCTACGCACTACTGTGAATTGGTGGTGGCAGATACG
GCCGATAGCAGAGTCACGACCGAAGCACTTCTAGCATGGCATTCACGATTTGGTGTGCCACCTATCTGGGTTCGGACAATGGCTCGCATTTTAAAAACGA
GGTCGTCGCCGACCTGAGCCGACTACGTACACAGCAGACATTTACGCCAGCTTACTGTCCATGGGTCAATGGGTCAGTCGAACGTGTCAATCGTGACATT
CTCCAAGTCATCAGGGCGATGATTTTAGCCTACAAGGTGAGCTACAAAGATTGGGTGTACTTGGTCCCAATGGTGCAGGCGAGTTTGAATCATACTGCTG
T