Description :
From Genome Similarity Track
Location :
Scaffold_1:821320- 824040
Sequence
2720 bases(100 bases per row)
CTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCACCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTCCAGCCTTGAT
ATTGGCCAGGAAAGACTCAGCCGTCATTTCCTCGAGGCTCAGTATCTCTGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAA
CCTGTCTCGCCATCGAAGAAGTGATAACACTCTTCCTTCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAGGCGACGTCGATCGGAA
CGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGTCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGAC
ATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAGCGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGC
ATTGTGTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGCTAAGGTCTGGGCGACCGTGTGTGGAACTCTGTTACCCACTCTGAACACGCTGT
TCTCAGTGTTCATGACAGCTGCAGCTGCCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTCTTCTGGGCGCTGCCAC
CATCAAAACATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTG
ACAGAGGTGGGAACATGACTCACCAATGCTCTGTTGGACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCT
TAAGACAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAGATCCAC
TTGGACGCTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCTTCGGACAACTTGTTGCTG
TTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTTTAAAGGGATGATCGTATCCCCGTACACATCCGTGTACTA
CGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCACACCCATCACGAAGACT
TAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGG
GGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCC
GAGTTCCATGGGAATTGGTCCGTTGGGGGCTTGCTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGTCTGGCGATGGCT
GTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGGTTGCCTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCGTTATGA
ACACGGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTTTTGCACATACTCGTGCAGTTCGCGCCTTCCTTG
CTTACACGCGAGGAAGCGCGAATGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACAT
CCAGGGGATGTTGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAG
CCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTTATCTTCAGCCGTATTGGCTTCGGGTG
AGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGC
TCAGCCGGTGTTGATACCACCAGGCTCTGCAGGGCCTCCATCCTGAAGATGCCTGCCATCTTCCGAACTGACTCGAACTGAGAGTCATTCATATGGGAGA
AGTCGTTCCTATCCATGGCAACGAACTTCGGAGAGGTTCAGGTAGTCTACCCACGGTGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGTCAC
GCAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAGAGAGCGAAGTGA
CCTAAATAAGGTAGATTGTAAACTGAGTATATAGATAGGTAGGTTAAGTTTGGGTTTAATACAAACTGTTAGTTACCTATAGAAATGCAATGTCATTTAA
CCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCTCGGTGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACAC
TTAGGGCTACGTACCCCGTT