Description :
From Genome Similarity Track
Location :
Scaffold_155:8213- 9415
Transcript NameFunction/comments
Phyra_72314aldehyde dehydrogenase, putative

Sequence
1202 bases(100 bases per row)
AAGGTGGCCGACTACTTCGCCAAGCTCGTGCAGCGCACGTCCCCCAAGAGCTACTTCCAGGCGCGCAACGAGGTCAAAGTCACGGGCAAATTCCTCGAGA
ACTTCTCGGGCGACCAGGTGCGCTTCCTGGCGCGCTCGTTCGGCGTGCCAGGCGACCACTTGGGTCAGACGAGCAACGGCCACCGCTGGCCGTACGGTCC
CGTGGCGCTCATCACGCCCTTCAACTTCCCCATTGAGATCCCAGTGCTCCAGATGATGGGCGCGCTCTTCATGGGCAACAAGGTGTTGCTCAAGGTGGAC
TCCAAGGTGTCCATCGTCATGCAGGAGACCCTGCGTCTGCTGCACGAGTGCGGCATGCCCCTGACCGATGTGGACTTTATCAACTCAGATGGCGCCGTGA
TGAACGACCTGCTGCTGCAGATCAAGCCGCGCAACACGCTGTTCACCGGGTACGTTTTTGCCATAAGGTTGTTATTCTACAGCTGGGCGGCTGACGTTTA
TGTTTCGTGACACCTTGTGCAGATCGCAGGCTGTTGCTGAGAAGCTCGCGAAGGACCTCAGCGGCCGCATTAAGCTTGAGGATGCTGGTTTCGACTGGAA
GGTGCTTGGCCCTGACGTCCGTGACTTTGACTACGTTGCCTGGACTTCTGACCAGGTACGCTTGCGCTTTGTGTTATTTTCATGCTACTTGAAGTTGCCA
TACTAACGAATACCTTCACTTTTTACAGGACGCGTACGCTTGCTCGGGACAAAAGTGCTCGGCGCAGTCGGTCCTCTTCATGCACAAGAACTGGGTGGAT
GCTGGCATCGAAAAGAAGCTTGTCGAGCTCGCTTCCCGACGCAATCTTTCGGACTTGACGATTGGCCCCGTGCTGACGGTCACCACAAAGCGTATGCTTG
ACCACGCTGCTGCTCTGTTGAAGATCCCGGGTGCTCGCGTCGCGTTTGGAGCCGAGGAGCTTGGTACATGCTGTTATTCTGCCGCCAATCGATAGGTGAA
CTGCTTACTAACGTGTTTACCGCGTTTTGCATCATGCAGAAAACCACACGATCCCGGAGAAGTATGGTGCGGTGAAGCCTACTGCTATCTTCGTTCCGCT
GAAGGAGTTTGTCAAGCCGGAGAACTTCGAGCTTGTGACCACGGAGATTTTCGGTCCGTTCCAAGTCCTGACTGAGTACGACGACAGCGAGCTGCCGCTT
GT