Description :
From Genome Similarity Track
Location :
Scaffold_26:82115- 85782
Transcript NameFunction/comments
Physo_344724ATP-binding Cassette (ABC) Superfamily

Sequence
3667 bases(100 bases per row)
CCTCCTTCAACTTCAGCAACTTGTACCGCTACGCCACGACGTTGGACAAAGTTCTACTCGCGGTCGGTATCATCACGACGGGAGCCAATGGCGCTTTGTT
CCCCCTCATGGCCATTGTCTTCGGCGATGTATTGACGGGGTTCACTACCACGCCTGTGGACATGGACAAGGTCAACAGCGCGGCTCTCGACTATCTGTAT
ATCGCCATCTTCCTCTTCATCACGGACTACGTCTCGTACGTGGCGTTCTACTACAGCGCCGAGCGACAGATAAAGGCACTGAGGGGTGAAGCGCTCAAGC
ACATGCTGTACATGGGCATCAGCTGGTACGACGCGCACGACGCGCTGCAGTTGTCCAGTCGGTTGACGGGCGACACGGTGAGGATCAGGGACGGCATGGG
CCACAAGCTCGGCGATTCGCTTCGATACTCGATCCAGTTTGTCGTGGGTTTTATCATCGGATCCGCCCATGGGTGGGATATCACGCTGGTGATGGCGTGT
GTGATGCCTGTCATGGCGCTCTCGCTCAACTGGATGATCAAGACGTTCACGATCATGTCGGACTTTGCCCAGAAGGTGTATGCTGAAGCAGGATCAGTGG
CCAAGGAGACACTGGGCTCTATCCGTACTGTGGCTTCGTTGAATGGAGAGCAGAAGGCAATTGAGAAGTTTGAGAGCAAGATTTTCAAGGCAGAGACGGA
AAACATCAAGCTGAACATGGTGGTGACAGTGGTGTATGCGCTGTTCTTGGCTAGTATGTGGATCATGTACTCCGTCGGACTCTGGTACGGCGGGTGGAAT
GCTTCAAAGGGGGAACCAACGCCGGGGGGTGTTTTCGCTGCCTTCTTTGGCGTCATGATGGGAACAGGTTCTCTCGGCCAGGTTTCCCCGAGTGTTTCCG
CTGTGGCTAAGGCCGCTGGTGCTGTTGAGCAACTGTTCGCGATCCTGGACACTGCGAGTGCTATCGATGCGGAGAAGGAGGACGAGGGAATCATTCCTGA
CACGTGTGAAGGCAAGATCGATGCGGTGAACGTCAACTTCACGTACCCGAGTCGTCCTGACGCCCAGATCCTGCGCGACTACAATGTCACCATTGAGCCT
GGTGTGACCGTGGCTTTCGCTGGTGCCAGTGGCGGCGGCAAGAGTACGCTGATTGCTCTGATTGAACGCTCTTACGACCCCACCAGCGGCACCATCTACC
TCGACGGACGGGATGTTAAGACACTGAACGTCAAGTGGCTGCGCTCGCAGATCGGCATGGTGTCGCAGGAACCTGTGCTGTTCGCCATGACCATCTTCGA
GAACATCGCCATGGGTGGCGACAACGTGACCCGTGAAGAGGCCATCGAGTCCTGCAAGCTGTCGAACGTGCACAACTTCATCATGTCCTTGCCGGAGCAG
TACGACACGCTGGTGGGCGAGAAGGGCGTCTCTCTATCTGGCGGTCAGAAGCAGCGAGTCGCCATTGCCCGTGCCATTGTCCGCAAGCCCAACATTTTGG
TGCTGGACGAGGCCACGAGCGCGCTGGATAACGAGAGCGAGAAGATTGTGCAGGCAGCGCTGAACAACCTGATGGCCACGACCAACATGACCACTCTCGT
AATCGCCCACCGGTTGAGCACCATCCGCAACGCGGACAAGATCGTGGTGTTGAATGAGGGCCACATTGTGGAGAGCGGCACGCACGACTAGCTCTTGAAG
ATCGAGCACGGCGTCTACCAGAACATGTACCGGATCCAGGAGCTGCGATCTCAGGAGGAGCAGCAAGAAGCGGAGAAGCGTGAGGCCGAGAACGGACTAG
AGAGTACGAAGATGACACGGACATTGAGTGGGGTATCGGCTAAGACTGACATTTCAGTGAGCGCGGTGGAGAAGAACTTCTTGGACAAGAAGCCGTTCAA
CCTGTTTGATTTACTGAAACTCAACGGACTCGCGCGGAACCACTTTGTCTTTGGGCTGGTCGGTTCCTGCGTCGGAGGCATTGCGGTGCCAGCTTCAGCC
CTATTAATCACGGGCATGATCACTGCTATGACGGAACAATACGCGCTCTTCGAGAGGACCTGGGGACCGATCTCACCTGACAACGTTGTACAACGACGTA
GAGCTGTACGGCATTCTCTACCTCGTCGGCGCTGCAGTGATCGCGATCTTCACGTATCTGCAAATGAACTGCTTCAAGTACATGGAAGAGAAGATCACGA
CACACTTGCGCACCGCCAACTTCAGGGGCTTGTGTTGACAGAATGTTGGCTTTTTCGACGAGAAGGAGAACGCGACTGGCGCGTTGACTGCTGATTTGGC
TACGAACGCCACCAAGGTTTCGCTGATGTCTGGAGTCCCAAGCTGCGTTTACCCAAGCTGTCTTCACTTTGATCGCTGCGCTTGTCATCTCCTTCGGGCT
CGGAAGTTGGCTGCTATCGCTCATCATGCTGGTGCTTTTCCCCATGTGGATTTTCGGGGAGGTGGCGCGTATGAAGGAGATGGAAGATGCTGGTTTGATT
TCAGATGACTTGGCAATCCCAGGAGCCCACGCGTCAGAAGTCGTTGGGAACATCCGCACGGTTGCCGCTTTGGGTATCGAGAAGAAGTCTGCCACCACGT
TTAATGAGCTGCTTCAAGAACCGCTGCGCAAGGGCCGGAAGGAAGAGCAGGTTAGTGGTCTGTCGCTGGGATTCAGCTCCTTCATCATGATGGCCACGTA
TGCGCTCGTGTTTTGGTTTGGAGCCAAGAAGGTGAACGACGGCACCGTTGGTTTTGCGGAGATGATGCGGACATTGATGGCCATCACGATGTCGATCCAG
ACGGTCAGTTTTTGCCTCCCGATTCTTGACTGACGGACCCAAAGCGTTCAAGGCCGGATCGACGATTTACGCACTTCGTGATCGCGTCGCCCCAATTGAT
TCATTCACCTCCGACGGATTCCGTCTAGCCAAGGTTGAGGGCCGCCTCGAGTTCAAGAACATCTCGTTCCGATACCCCGCGCGCCCGGAGATCAACGTGC
TCAAGAACTACAACCTCACTATTGAACCCGGCCAGACGGTGGCGTTCTGCGGCCCTAGTGGTGGAGGCAAGAGCACTATCATCTCGGGGATCGAGCGGTT
CTACGACCCCGTGGTTGGCGAAGAGCTGCTCGACGGCCGCAACATCAAGGACCTGAACCTGAACTGGCTGCGCAGTCAGATGGGTCTGGTAGGCCAGGAG
CCCACACTGTTTATCGGTACTATCGCCGAGAACATCGCGTACGGTCTGGCCGAGCAGCCGAGTCAGCAGGAGATCGACGAGGCCGCTAAGATGGCCAACG
CGCACGACTTCATCACGCATTTCCCGGACGGCTACGAGACGCAGGTGGGCATGAAGGGCGAGCAGTTGTCTGGCGGCCAGAAGCAGCGCATCGCCATCGC
GCGTGCGATCCTGAAGAACCCCAATATTTTGCTGCTGGACGAGGCCACAAGCGCTTTGGACTCGGAGAGGTGCAGGAGGCTCTGGACAAGGTGGTGGCGC
TGAAGCGGCGGACGACGATCGTCATTGCTCACCGGTTGTCTACGATTCGTCGCGCCGACAAGATCTGCGTGGTGAGTGGAGGCAAGATCGCGGAGCAGGG
CACGCACCAGGAGCTGCTGCAGCTAAACGGCATTTATGCCAACTTGGTCGAGTCAGCTACTGCTTAG