Description :
From Genome Similarity Track
Location :
scaffold_204:8211- 14257
Transcript NameFunction/comments
g5608.t1 hypothetical protein PHYSODRAFT_502426

Sequence
6046 bases(100 bases per row)
ATATCATCAGGAGCATTTGACAAACGCTCGAGAAGGTCGTTTTCCAGCTGTAACAACTGGATCTGGTAGCCGTTGAACTCCTGCTGGAGCTGCCGCTTCT
GGGTCTCCAAGTCGGGCTGCTCCAAGTTTACCACGTTAGCCAGCAGTTGGTCCTCCAGCCCCTTCTCCGTGACGCTAAAGTCGATCAGCGTGCAGTACGC
CAGGATCTCCGGCCGGTAGTGCGGGTTCGGCAGTTTCGTGTGCAGATACAAACGGAAGCGAGGGTCCACTTCGATCTCTTCGGCTGCGAACTGGAGGAAC
CAGTTGCGTCCCTTCTTGTAGATTTGCCGCATGATGACAGGCTCTAAAGACGCGTCAATGGCTTCGCCCAGGCTCTCCAGGATCACGCTCTGGCCGCTGC
TGATTGCCGTCTTCAACGTCGTCGTCCAGTTCTTCTGAGCTGGTTGAAGGATCACTAGAGACTGAGCTACCGACTCCTGCTCGGTTGTCCCGTCCGGCTT
CTTATGGCTGAAATCCCGGGCACGGAGCCAGATGATGCCCTGCAGCTGCGGGTCCACCAGAAGCGGCCACCGCTGACAGGACGTGATGATGCAGCCATTC
TCAATGGAGATGCGGTCGGCCGGCAGCCCCTCGTTCATCCATTGAGCCACGTCGCTACTGTCACTGAGCACATCGAGCGGATCCACGCCTGTATTTTCAC
TCGGAGGTGTCGAAGAAGGAGGTTCCACTGTAGATTCAGCTGTAGCCTCCCCGTTCGCAGTCGTTTCGACCACACTGCTCATATCTACGGGGGTTGCGAG
CGTAATTGGGATCTCCCGGGTTACGATGTCAGGCAGCCACGTGTTTTTCCAGAGCTGGGCCCGGAAACTGGCGTTGAAGGCGCCAATGTAGCTGACGAAC
CCCGCAGCGAGCAGAGAATCGCCAATCAACGAGCTCTCTCCGGCCCGTAACACGTCGATTTCGTGACTCCAGCGCTCGTTCTCAGACGCCAAACCATTCA
CGAGTCGTTCAGCTAGGGACAAGCGTTCTTGGCAGGCTTGAGCCTCCGCTTCGACCTTAGCTTTCTCGTTCGTGGCATCTCGGAACGAAGCTTGTAAGGC
GTTTAACTGGCCTTCAACCTCCGCCACCATCTTCTGTACTGCAGCCAGTTCCGTGTCCGCTTCCGCTTTCGTCTGACGAGCTTTCTCCAGTGTATCCATG
AGCGGTTTGACACGGACGAAGACCTGGTGGAAGGAAATGATGTTGACCACCCATACGCACAAGTTGGCGGCAGCGACGGACTTGCTCTTCATCTTCTCGT
AGTTGAAGTTCGGGTCTTCCTGGATCAGCGGCTCCACTCGTGCGACGACGTCCAACGGAATGTTCTCCTTGTCGTACTGCTCCAAGGACTGCTTGAAGAC
ATCCACTTTGGCCATCATCTTCTTGGCGTTGTCCCAGCTGAAGTTCTTCGTCTCCTTTTTGATCATCATGAGCACAGCCGCTGTCACCTTCTCCACGCCA
GCGGGCGGCTTCCCCATCGACTTGAGCTCAGTCAGCGACGCCTTGTTCAGGCAGTTCACAGCCTGTTGGGCTGCGTCCAGAGCGGGTTTGGCGATCGCAA
GCTCAACGGAAGCCTGCGCCTCAATCTGCGTAGCGATCTCAGCCGCCTGGGCCGCTTTGGCTCGCTCCTCGTCTGCCCTACGCTGTTTCACCTCCGCGTC
GCCGCGTTGCTTGCCCATCTGCTCCAGCAACAGGTCGGTGGCTTTCTTCCGCTCCTCCACCTTCTTCATGGTCAGCTTTAGCTCGTCTTGTAATCCCGCA
ACATCCAGCGACGTCTTCTTCAGTGTAGCCAATCCCACTTCGAGACGCTTAATCTTGAGTGTTTGGGACGATCTCTTGGCTTCCAACAGCGAGCGGTAGA
AGCGAATGAGCTCCAGGAACGACGTGGGCGTCACGTAGTTGTGGCGCCCGTAGCTCTTGGCGTACAGTGCGCAAGCTGCCGTCACTGACATGTGCATCTC
GGCCATGTGATGGCAGACGTTCTCCTGAATGGCGCGCGTAGACAGCTCCACGTCCTGCAGGAAGTTGAGGGACACGTCCACTAGCGCCTCTTTCGGCCAC
GGATGGAACCAATTCATGATGCAGCAGCTCATGAGCGACGGGAAGTTCCTGCATCGAACCCTAAGGTCAACCCCCACAGGTGAAAACGCCAAGATCAGAT
GCAGATTGGACCGCACACGCTCGTAGAAGAACTCCTGAAGCTGTTCCTTAGTGTCCGGAATACCTCGAGCCTTCGCCTCCAGTCGTATAGATCCAGCCAT
GGACTCCATCTCTTCACTGGAAAATAAATCCGAGATGTAGCCGGACGTTAAGGCATCCGTCAGAGGCACCAAGAAGCGGTTGTCCGTGATCTGCGAGTCT
GTGAGCAGCAGGACAATAGGTTTCGCGGGTCGAACGCCAGCTTTCCGGTAGATGTCCTTCAAGTCCTCCTTTAACTCGGTCGTCCCGTAGGACGGAGACG
CACTGGTAGTAAGCGATACTAAACTGTAACCGCAGATAAAGGCGGCCAAGCGAGAGAGCGACTGCTTTCCGGACCCTCCAACTCCAATCAGCAACGCGTT
CCCTCGAGGGTTGGCCAGGATGCGGACGATCCGAGTCACGTGCTCTAAGGCTTGGTCAAACAGCACGAGACTCATAACCGGGTGCGTCTCGTTGTATTCC
GCCAGCTTCCGTTCCAGACACGCCGTGAGTTGTGTCTTGTCCACAACGGGGACGTAACTAAGCGTTGAGCCTCCATACTCTTCCGCCGTTGAAGATCCCA
GGAAATTCACACAAATCAGAGGCAAAGCGAAGACTTGAGCCTGATCCTCTTCGAAGTTCTTCTTCGTCTGCTCCACTGCCATTTCGTTGAAGCGCTGGAT
CTCGCTGGGCGAACTCATGCGGTCGCTAAAGACACGGAAACACTCGTGGGTCCAGAGGCGACAGAACTGCAGCGAATTGTTGAGGTAAGCTTCGGGTTTC
GCCATGAAAAGGCCTTGGAACAAGGAGCTGAGCTCCCTCATGCTGAACACGTAGTGGAACTTGGTCGCCGTGGGAAGGAAGTTGGCGCGAACCTCCGCAT
ACAGATCAATTGTGGCCGTGACGATACTAGGTGCAAGTTTCTTGATTTTGTCTGCGAAGTTGGTCAGATGCTGGGTCAACAGAGCCGAGTAGATGGTTGT
AAGGTCCTGCTTGGAAGGCATACTGATGCATAGCGTTGAAAAGTGGCGGTGTAAGCGAGGATTGACTGTGAAGGAGCCGGCCTTGTGGTTCATACAGGCG
AGGAACTGGACGTCCTGGATGATCTTCTTGGACGAGAGGTCGTGGCGGTCATACCACGACTGGTAGTCCATGTGCTGGCGCAGTAAAGCAAGCGCTGTCT
GAGTGCCGAACTCCTCCACGAACGGCATGTTGAGGTCGTCCAGGAAGTAAATTAACTTGCGGTTGTACAGCGGACCATAGACTCGACCCGATCTCTTGTC
GAGGCACTGCTCCAGTCGCAATTGCAGCTCTCGCGCGTCCATGTAGTGGTGCAGACTCACGTACGTGAACGTGACATCGTCCTCCAGTCCTTTCAAGTGT
TCATGCACTAGTGACGACTTCCCGGAGCCACTGGAGCCAACCAGGATCGTCGGGTTCCTCCTACGCAACAACAAGTCGATGATGGAGTGTAGACGAGTGG
ACTCGAGCGTGGGGACCACGAGCGCGTGGAACGGGACGTCCCCTACAGGCAGCAAGGCTGGCACTTTGTCCCCCCAGTAGACCAGCTCGTTACGAATGAT
GTCGTAGTGGAAATCAAACAGATTGGCACTGCCAGTGGCCAACACATTGGCGTCAGCGCCTCCCGAAACGAATTTGTACTTGGCAACAGCCTTGAAATGT
GTCGAGAAGGCTACACGATCATCCGTCCCCTTGTCAGTAGTCAATGCGCCTCCGAACGCCCACAATCCACAGTAGATGAACGCATTCTCCAGCACTTCCG
GAGTCTTCTCCTGCTCGCCAACGCCGCTCAAGAGCCCGTCCAGTAAACGGCACAGCATTTCCACAATAGCAATGGACACCACAGGCACAATCATCTCCGC
CTTGGTCTCGTCCAGAGCCAGGAACATGCCGTCCACGTACTTCTTGAAGAGGCCGGGAAGGATCCCAGCCTCCGCGCTGCTTTCGCGTTGCTGCAGCCAC
GACTCGACCGCTGGATACCAACCGATGTGGCCTTCATCCACGTAGATGATGCCTGCGCGCGAGACGGTGGCGGGCGTGGCGTTCACAAGCGACGAGATCT
CAAACACCAGCCTCATGGACTTGGTCAGGGGAATCCGCTCGTTGGAGACCAGAGTAAGCACCTTGTTGTCGTCCATCACAGTATTCATACTCTCGATCCA
GACGGCGTCGATGTCCCCGTCGAGAACCACCCACTTGTACGTCTGCGAGTCACTGAAAGGAGCTGAATTCTTGGACATATTCCGCATGATAGAGGACAGA
ACGCCGTCTCGCCAGTCGTTGTCCAGTGTCATGTAGCCGTAGAGCTCGTCGGCTGTGATGGCCTTAGGATTCACACTCTCGAATACAGTCAAGTGCTTGG
CCAAGGGGTTTCCTTCCTCGTCAGCGTTGTGGCAGGCAGCCAGCGTACTCCAGATCGTGCTCTTACCACATCCAGCCGGGCCAATCAACATGACGCTGTG
CCGCACCTTGAGCACTTCCTCGAACTCCACCATCTTCTTTAGGAAACCCTCTTCCGGCTGGAGCTTCTTTTGAGCACAAACTCGAGTGCATTTGGTCTGT
AGCGAAGAATTTTTTAAGTGAGGGAGCTCCTGGTTCGGGAAGAGGTCTTTAAGTAGCCCCATGAACACTGGGTAGTCTGGAGGGAGGATCCGCGGCGTGT
TGAAGTCTCGAAGCACCTGCATCAGCACAGTCTCTTCTGAAAGAGTTGAATACGCCCGCCGTAGACTCCCCGCGACAAGGAGAACAGACTTTACGGACCG
CAGCCCCCAGTCATAGTGTTTTTGCTTGGACAAGAGCTCGCAGCTGAGGTCGTACAGCGTCACGAACTTGACGGACAGCGTACGGGCCTTCAGAAAGCCT
TCAGCCATCAACATGTTCTCGCAAATGGGCTGCAAGTCAGGCTTGATCATAGCACACGAACGGAACAAAGCCTTGAGATTCTCCGGCAGCTCTGCGCGAC
CCGCGTAGCCAGGATTCATGGTGATGAAGAAGCCCACAGTCGGTACCAAGGCGATGGTTTTGCCGAAGAACTCGCAGTTTCCAGTTCTAGGCATTGTTAC
AGGCTGCACGCTTCCTTCTCCGGACGAGTTGACTTCAGTTGATGGCCCACGGTTCGTACTCCCAACTAGCAACGTGTTCGCATCCAGCACGGTCTTCACC
TGCGTGGCGACCACCGACAACACTTCGACTGAGATGCGGTTGAACTCATCAAAGCAGCCCCACGCCCCCGTCTGAGCCAAGCCTCGGAAGATGTTGGCCA
TCGTCAAGTAGTTCATCTGGTCGCTGCAGTTGAACACGTAGCACTGGAGGCCCATTCCACGGGCCAGGTCCTTCGTCGTCTCAGTTTTTCCTGTACCTGC
AGGCCCCGCTGGAGCTCCGCCGAGACACAGCCGCAGAGCTGTTGTAAGTGTGACGTAGCAGCGGTCAGTCAGCGGTGTGATCACCAAACGTCCGCAGTTC
CCCGTGTACTCGTAGCTGTAGAAGGATCGGAAGTCGCAGATCTTAATATGCACCTCCTTCTTCTGGCCGGCGCTGGTCAGGACGGGCGTCGTGTAGTACC
GCAGTTGCGACTGCCACTGGAAGTCCAGCGAGCTCGAGACCTTCTTGGTGATCAGCGACTGCACCACGTCCCGCGCGTGCACATCGACGGTAATGAGCGT
GATGATCTTCTGCCGGTCCAGCGCTGCGAGCTTCCCCTGAACAAGTTTGATGAGCTCTTCCAGCCGCACTGTCGAGACGTCGTAGTACTTCCTGATAGCA
TCCTCCGTGCCGTTCTCGAACTCTTCCAACGCGCTTTCCACCTCCT