Description :
From Genome Similarity Track
Location :
Scaffold_230:8211- 11269
Sequence
3058 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGCTCTTTCAGATCGGGTGCAAACTTGACGGCGGAGCTCCAGAT
GGCCCAAGATGCTAGCGACAAGCTGCGTCTTTGCACGCCATTCAACACAAACCTTGCGAGCCCAGGTCCATGGCCAGGCTATGGAGATCCAGGGGTGGGA
GCACCGTGCGCCCTCTCGTTGGCAGGACTTACGACTCTTGTTGGCCGATCAAGCGGTCGAGATCCGCGACTTGACTGGACGGCTGGAACGCGCGTCCCGT
CAGCGAGATGGTATGCGAGATGACAACGACCACCTCCTTAGGGAGATGGCGCTCGCCGGATCTGAGATCCACCAGCTCCAATCCCGGATCCATGACCTCA
AGCGGGATCTGAAGGATTCCCAGACTGCTAGTGCGTCCGCGGACGAGAGCTTGGATCGACTCCGTGACGAGTTGCGCCTGTCCCAAGAGGAGGTGGTAAC
CAACGACTATGTGGGATGCACCCATGGCGGATCCGCCTTAGGGTCGGCGCGTGGAGGGTCCCCCGCGCCAAATCCATCTCCCTCGTCGCCGGATGTAGCT
CTGGCTCAACGCTCTGAGGAGTTGAAAGATACCAAGGAGTCGCTCGAGAAAGCGTCTGCTGGGCGAGATTACGCGCTCGAAGCGTTCGTACGCATAACTC
AATTGCGCGACGAGATCCAAGCAAAGCTGACTCCAGCGGGACAAGGCGACTACGGAGTGGGCGGATGCCAAGCGGACGCAAACGGAGCTGTAATCCAAGC
TCCGCCGCACGAGTACGTGGATCCTCTTTTGGTCCCTGCTAGTAACTCCATATTCACTTGTTACGTCAATCCAGGTGACAAATTGAAGGATGCCGATGCA
ACCTCAGCGAAACTCCAGGATCAACTCGCTGCAGCTCAAACTCATCAGCAACAGCTGGTTCTGGAGCGCGATCGTGGCTTATCGGAGCGGGATTTGGCAC
GTCGACGACCGGCGCTGGTGACAGCTGCTGTCTCGGATTCCCTTTCTCCCCTGTCTGGGCCTTCTCCTGCTGCCAGCGTTTCTGCTTCTCTACCGCCTGT
AAGGGGGGGGGCGGATCCGTCGGCTGCGAAACGACCGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN