Description :
From Genome Similarity Track
Location :
Scaffold_12:82103- 86179
Transcript NameFunction/comments
Phyke_g2286Putative cullin putative
Phyke_g2287hypothetical protein PHYSODRAFT_538076

Sequence
4076 bases(100 bases per row)
ATGGGAAGAACATGATCACGCTGGAGGAAGGCTGGGACCAGGAGATCAAACCCAAGGCTATCGACGTGCTACTGGATATTCTGGACCAGGGCATCGACCA
AATCAAGGTGTCACCCTTCCCGCCCAATGCCTTCATGCCCATCTACACGACGTGCTACAACATGTGCACACAGCGCTCTCCATTCAACTTCTCGGAGCAA
CTATACGACCGCCACGGCCAGACTTTCGATACCTAtttggagctgaaggtgctACCTAGTCTGGAACAGGCGCACGACGAGTTTTTCCTCCAGGAACTGG
TCAAACGATGGACCAACCACAAGCTcatgatgaagtggatgacCCGCTTCTTCATGTACTTGGATCGGTACTATGTGAAGCACCACTCACTACCGACGTT
GGACGACGCTGGACTGCAGAGCTTTGATCGGATGGTGTTCCAGAAGGTTAAAGTACGCGTCAAGGACGCGATGATTGAGCTCATTGAGAAGGAACGCAAC
GGAGAGATCATTGACACCACTCTCATGCGGAACTGCGTCGAGATCTTTGAGGTCATGGGCATGAAGTCACTGGATGTGTACCAGTCGTGTCTGGAGACTG
ATCTCGTAGCCACCAGTGCGACGTACTACGAACGCAAGTCGAAGGGGTGGCTCAGTGAAGACTCGACACCCGTGTATCTCCAGaaggtggaagaagctct
ACAGAGCGAGCGCAACCGTGTGCACACGTACCTGCACAAGTCCACGGAACCCAAATTGGTGAAAAAGCTAGAGAGTGTGTTGCTGGAGGCAGCACAGAAG
GAGCTGGTTGAGCGCGAGAACTCAGGTGTGATTgcactgctgaagaatgaCAAGCTGGATGACCTGGCGCGCATGTATCGGCTGTTCTCACGCCTGAAGA
ACGGGCTTGAGCCTATCGCTGACCTGGTGCAGAAGCACATTACGGCTGTGGGCAATGATATTGTGGACAAACGCGCCAACGCTGTGGCCACGGGTAACGT
GCGCGACCCTAGCTCGGATCCGACATTTATCAAGGACATTTTAACCATCCACGACAAGTTCCGCAACATTGTGAACGAGCAGTTTGCGGGTAACTCACTC
TTCCAGAAGGCCCTAAAGGAGGCGTTCGTGGAGTTCGTGAACAAGGATGTTGGCCCGGATAGCTCGGCGAAACTGATGAGTACGTTCTGCGACCGCATTC
TCAAGACTGGTGGCGAGAAACTCAGCGACGAGCAGGTCGAGGATTACCTAGAGAAGGTGGTGTTCGTGTTCTCATACCTTACGGACAAGGACCTATTCGC
CGAAATTTACCGCAATCAGTTAGCTAAGCGCTTGCTGAATCAGCGATCAGCATCTGCAGATGCGGAGGTGCTTATGATTGGCAAGCTCAAACTGCGGTGC
GGTGCTCAGTTCACAGGAAAGATGGAGGGTATGATGAACGATCTGGCGATTGGCAGCGATCACCACCAGGAATTCGAGGGTTttttgaagaagcagcgcg
aaAGCAGTGCGTCGAAGGAGGCTGCCTTGAACATGGAGTTCAGCGTGCAAGTCTTGACGACGGGCTACTGGCCGTCGTACCGCATTTTGGAGATTACGAT
GCCACCCCTCATGGTCCGCTGTATGAATATGTTTAAGGTGTACTACGACTCGAAAACGAGCCATCGCCGGTTGCAATGGGTGCACTCGTTGGGTAATGCA
ACGATCCGCGCCAACTTCCCGAAGAAGAAATGGTACGATCTGCAGGTGACGACCCTGCAGGCTGTGGCACTGCTTCTGTTCAACGAAGGTGAGGGCTCGC
TCACCTTCGAATCCGTCCGCGAGTCTCTGAACCTGTCCGTggatgtggtgaagcgtaTCATGCACTCGCTTTCGTGCGGTAAGTATAAGCTACTGACAAA
GACACCCACGGGGAAGACTATTTCAACCAGCGACCAGTTTACAGTGAACCGCACGTTTGCGTCACCCATGCGCAAGCTGCGCATTCCGATGGCCTCTTTG
GAGGAAAGTCACAGCCAAAAGAACGTGGAAGAGGACCGCAGCATAGCCATAGAAGCCGCCATCGTGCGTATTATGAAGGCACGTAAGTcgctgcaacacc
agcagctcatctCTGAAGTGTTGAGCCAGCTCGCGTTCTTCAAGCCGAACCTGAAGGTCATCAAGCGCAGAATCGAGGCCCTCATTGATCGTGAGTACCT
TGAGCGCGACCCTGACAAGGCCAACACCTACCGCTACCTCGCATAAGCTGCTCCTCAATTACCTACCTCTTTTAAGGCGTGGCGATGGAGTATGTTTCCT
AGCGTAAAGGCACCAATAAAGGTTTTCCAAGCACGTTCATGAGATTTCTACTTGCTGGTGTCGTTATCGCTGTGGTTTGCAGTTTGAGAGCAAAAATATG
AGCGCTCAGGCTCAGGTACAACAAACACACATGAGGCTTTATGAAAGTGAACCGACTGCGTGTTATACAGTTTGGAAATGCATCTACTTCTTGAAGAATC
GATTAAGCGCCGTCGGTGCGCTCTCCGCTTTTTCGTTCCactcgcgttgctgctcatgtCGCTCCTCGCGTTTTTTCTTGTTAGCCTGTTGCTCACGGAA
TTGCTCCTTCTGTGCATCGACGACGttctgttgcttcttgcGTAGTCGTCGCGATGGCCGGTTGCGACCacgcatttttttcttgggcttcttggcACTA
CCATCTCCGTTGATGCGCTCCATCTGGAACACTTTCTTTTTCTGCTCCATGGCCGGGTCCACGTCCACACGTCCGATGGCGTTCGGGTCCAGAGTGATCA
TCTCTGGTCGCAGCTTCTCTAGCAGTGAGTGCACTTCTGCCTCGCTACGCTGCTTGTAGTTTTCGTACGGGTTGGCTTCGTACGTGTCAAAGTTAGGTTC
ACCGGAGCCTGGAATCACTACGGAGTTGAAGCCCATAGCATGACCAACACCGAGTACATCTTCGAATGGGCGGAAGGCCAGCGAGCTCACTTGAGAGCTA
GGAATTTGGTGCGTCATGTATGGCCGGATCGGTGATCCCGAGGAGAAGGCACTCTTCAGCACGTGCACGTTCGGGCCAAAACCCACTGCCACAAGTCCGC
GCTGACTCACACTAATTGTATTGGCTGCCGCTGTCAGGTAGTAGCTGTTCACTTCCTGGTATCTGCGAAGATCGAACACCTTGACCTTCCTGTCAGCTCC
AGCGGTAACGAGATACTTTCCACTGTTGTCGATGCCCATGGAGCGAACTGGCGTACCACCACAAGAACAAAACGATCACATTGCAACGTAAGTCAACTGC
CAAACCGGGCACCAAGCACACAACATTGAAAAAAAGATATAAAAAACACGTACTGGGTCCCTGGTGGCACTGCATCTTGACGACAGCATCCGCCATGTTT
GGCGTCCATAAAGTCGCGATACCGTTGGCGTGACCGAGGTTCACAACGGCGTTCCACGGGTTCAGCGCCATGGTATCACAAAGCCCCTGCTTCGTGCGGT
GCGTGGACACCTGCTTTCCGTCGGTCACATCATGGTACGTCAAAACTCCATTGCCGCTTACCACAGAAAGCAAAAAATGATACGGCAGGAACTCCATCTT
CCTCGGCTGCGAGATCGTGCGGATACAGTGAGCCTCAGCACCGGTATTGTCGTAAATGTACACGTGTTTCTTCTGCGCAGCTGCAAACAGCGAGTCATTG
TGCAAGAAGCTCACATCACGCACCAAGTCATTGGCCTGGAATTCACACGTAAGTTTCATACGGAGCGTGTCCATCAAGGCCAAGTGGCCCTTCTGGCTGC
CGAGCAACATGTTACGGCCATTGCGCGTGTACCGCGCACGGTACGCGCCATAGTCTGGCAAGTCCAAGCTGAATATCTTGCGCGCCGTATTGAGGTCTAC
GCTATccgcgagcagcttctgcgaGAACTTGTACGTCTTCTCGAGGCCTTCAGCCTCCATGAATCCGACCTGGTCAGGCAGTAAAATCTCCGCCTTGGCA
GCAGACTCAGCTGCAAGCTTCTGTTTCTCATCGGCTCGCAGTAGTGCacccttgagcttcttgtcgcgGATGCGCT