Description :
From Genome Similarity Track
Location :
Scaffold_1760:821- 3837
Sequence
3016 bases(100 bases per row)
CCAGATGCTGAGAAGTGTTTGACCTTTGCGGAACTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGGATAAGTGGCCAG
ATTTGCTGCGCAGTTTCCAGACCCAGTACGGTGGATTAGGAGTGTCGGTGGCACGACAACACTACTACGCTCACCGCAGATCGGATGAATTCCCGCTAGA
ATACCTACATCAACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAG
ACGGTGGGGGGCGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAAC
ACCGCCAGAAGAAGGCGGCGATCGGATCCGGCAAGTATCGCCGAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGA
CTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCTGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGA
GACAACTCTCGACCGGGGGATACCGTATCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTGCG
GATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCG
CGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTG
CCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGTTCGCCGAGTTTGAATCCGGTACGAGCCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACA
AGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGT
GGATGAGTTTGCCAGATCCGAAGTCTCTCCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAAAAACGCCAACATGGTCGATGGTTTGAG
CCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGG
AGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGA
TAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAA
GGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGAC
GCCATCCTCGGGATGGATTTCATGGTGCCAGCCGAAGTGAGGTTGGATCTCACTTTGTTGACGGCGGCCGTTGTATGGGGCGAAGATGAGGATCATAAGG
GCGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGAAGCTGCCAGATAGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGA
AATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGAT
CGGGCGATGGTTGGCGAAGGATGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGCGTACGAGGCG
ACTACCGAGATCGAGTCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTAGACCGGCCTTCATATCCAACTCCGCGAAAGATCCTGC
AGAGAAATCGTCGGATCGAGATCCAAGCGATGGAGGTTGGATCCACGACGGGGGATGATCCTCAGAGTCGTCCCCTAGATAACGCAGGATCGGTGGACGA
GGGATCGCAGAGGGCTGAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGATCCTAACTTTGCATGGGGCAAAGTGTCTGGATCCTTGTCGAGAGTG
GCCGCACTAGCTAAACAGGAACCATCGTGGGTAAACCCTCCAGAGGATCAAGTCGATCCAAAAGGTGGATTCTCCAGTACAAGGATACCCGACCCCACGA
AGACAGAAGGGATGACGGTTAAAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATCCGACAAAGACTGAAGATGAGCAAGTCTGCTACCGTGAAGGCG
GGGATCTACACGCCGAGGATCTTGGAGAAGGTATGGCGGTGATCCCGAAGGTACCACTGACCACCGAGGAGGTCACGATTGATGATATCCAAGTGGATCC
AGGGGCGAACGAGCCCACGGAAGTGGATCGTCTACGTCAGAAGACCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCCGCC
CGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGA
TTAAGGGCCTGCTGCAAGCCAAGATCATCAGCTTCTCAACGTTCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCT
GTTTATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGG
TACTGTTCTCTAGACA