Description :
From Genome Similarity Track
Location :
Scaffold_2833:821- 2751
Sequence
1930 bases(100 bases per row)
CTGGAGTCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCATAAATCACCAGCCTTTTCGGATCCTGTCCTTTTAGTAGATC
CAAACCCAACAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCCTCCGCATAAGTGTCTCTGGCCCGTACGACTTCCCATCCGGGCAGTCTCCAC
AGCATTGCGCTGTATGCTCTTCCTCCACGTCGTACGCGAGCGGATCCATTGAAGATCAGGACGTACAGATCCTCATCCACTTGTACCGTCGGGATCGGGA
TCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAAACTCCCAGGAT
CTCGTCTTCCCCTTTCGAACATTTCATAATCTCCAGCGTCTAAGGTGAGAGTAAGGCTGCCCATTGCCCCAACCGTCCTTGTAAGCCGGCCGACTTGAAC
AACCAAGCTAGCGTAGTGTGTCGAGTCAGGATCCGGATGGATTTTCCCACCAGCAGGTTATAATTGAGATCCAACACTCGCAGGAGCGCGAGTATCTCCT
TCGCCACCGCTCCGTAATTCAGCTCATTCGGCCTTAGCGTCCGGCTGACGAAGGTGACTGGATGACAGATCTCCTCATGTTCTTGTACCAAGGCTGCTGA
GACTGTCCAGTCACTGGCATAAACTATCACCGTAGGTTAACGTTCTGGATCGAAATGGCGGAGGATGGGCGTCGTCGCGATCCTGTTCATTAGCTCCACG
AACGCGTGCTGGGCTCGGATCCACCGAGGCTCCACCTTTTCCGAGTTCTCTTCCATCCAAATTGTATCCTCTTTCCGTTGGTCCCGGGGTGGATCCAGCT
CCTGTTTTAGGTCCTCTTCCGGCGTTGTGCTACTTGGATCCCTTCGTGGATCCGATATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGA
AGTGGTCATCGCAGCAAAATCCACCTCTCTCAATTCATAGAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCC
AAGAAGGATTGCATCACCCGTAACGATTGTGGGAAGGGCAAGTCTGCCAACGAGGACAGGTCCTTAGGATTCGCCTCCAGTTCCTCCTTGGAGACTCGAT
GACCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACGCTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGAGATGTCACTCTCTC
GCACAACTGATCTCACGATTCTGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAGCACAGATGGAGTCCCAGGATCCCCTGGCTCTCCTGCT
TCGAATGGATCCACTTCCGTATGACCTTCCCCGGATCCACCCCTTTCGGGTTCCGGGATTCGGGTGAATCCGTAGAGGGCGTTATCGATCAGGCGTTGAT
AGATCTGGGGCACATTCTTCAATCCAAACGGCATCCGGTTCCATTCGAACAGTCCAAATGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCAT
AGTCACCACCCAGAAACCACTGGCCATATCTAGAGAACAATACCAGAGTACTTTATCCAAATCCTCCAATAGCTCATTGATTAGAGGCATTGGATACACC
ATCAGTCGGGTCAGGCCGTTAATTAGCCGGTAATCAATACACAGACGTATATCCACTCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGG
ACGTTGAGAAACTGATGATTTTGGCTTGCAGCAGACCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCACCACCTTCCGCACCCTTTGAGCGAT
CGGCTTCGCGTCACCGACATCGATGTCACA