Description :
From Genome Similarity Track
Location :
contig_57:82081- 83617
Transcript NameFunction/comments
g10945.t1POM77929.1 L-threonine 3-dehydrogenase [Phytophthora palmivora var. palmivora

Sequence
1536 bases(100 bases per row)
AGATCCTGGCTTCCACGTCAAACGTTTGCTGTCTGGGTGTCCTGATCTTGCTTCCCGTGGTGCAGGGTGCAGTAGTTGTTGTTGCGCTCGTACGCAGCCT
TCTTGCAGCCCAAGTGCATGCAGCGTTTGCCGCCTCCGTGGGCCCAGCACAAGCTGTTCGAGATGGCAACCTTCGCGCAGTCACTTTGGGAGCACTTGGT
GCCGCCTCCATGGGACCAACAGAGACCGCGCGACTTGCCTCGCCGATCGCAGCCCTCCGTCAGACACTTCACCCAGCCACCTACGACAAGGAGTTCCTTG
AACATGTGCAGTAGTTCAAAGCCTGGTGGTTATCTTACCGTGTTTCCAGCACAAGCCCGCATGCTTGGCACTTGATCGACAGCCTTCAGCTGCGCATTTC
TTGCCGCCCTGGACGAGGAGTCACAGCAGACGACACGCCGGTCATGCCAGGAACAGAAACACACCCGGTTGTCGAGACGTACTTACCCCGTGCCGAAAGC
ACAGCCTCTTGTTGATGATGTAGTTCTCGCAGCCGTCGACCTTGCACTCTCGAGCTCTGCGCTTCTCTTCGGTCGCTGGAGATCGTGCTTGTCTTGACCT
TGCAGCGGGGGTCGATACCTCTTGATCAGGAACGGGGACATTCTCGGAGCTGTTCATGATGAAAGCCACCGACGCCTTGCTGCTGGTCGCCATTGCACTC
AGCTCGATCGACGTCTCTTTGACAAATGGATTCCTTGCGTCGAGCTGGGCGAGATCTCATTCCTGCATCAAGCTGAGGCCGCCGGGAAGCGTCACTTTAG
GTAGCGAGCGAGGATGCAACTGCTGACCAAGCTGCTGCCACGCGGGCCGCGTCGTGTTTCACTGTCATATATTCCGAGGAGCGTGTTATCTATTGAGCTA
TCTTACGCTGTCTCCTCGACAGCTTCGGGCTTGGAGAGCTTGGCGTCGAGCTTGACGAGCATGTCCTCAACCATGCTGTCCAGGTCAAAGTCGTGCTGCC
AGCCCCAATCCCTCCGGGCGATGCTGTCATCCAGCGAGCGCGGCCACGTCTCGGCGATCTGCTGGCGGAAGTCGGGCTTGTAATCGCACTGGAAGCTCGG
CATGACCTTCTGGATGGACGCCACCATCTCCTCGGGTGTGAAGGACACGGCCGTGATGTTGTACGTGCGCTGCGTCAAGCAGTCGTTGGGTGCGTTGATA
AGCCCCAGCGTGGCCTTGAGGCAGTCGGGCATGTACATCATGGGCAGCTTGGCGTCCGGCTCGAGGAAGCACGTGTACTTGCCGTGCTTGAGTGCGTCGT
AGAAGATCTCGACGGCGTAGTCCGTGGTGCCTCCGCCAGGCAGCGCCTCGGACGAGATCACGCCCGGGTACCGCACCGAGCGGAAGTCCACGCCAAATTT
GTTGTGGTAGTACTCGCCCAGCAGCTCCACGTGCACCTTGGTGAGTCCGTACATGGTCGTGGGGCGCATGATGGTCGTGTCGGGCGTCTCGTCCTGCGGC
GTAGAAGGCCCGAAGACTGCAATGGTGGAGGGTGCA