Description :
From Genome Similarity Track
Location :
Scaffold_291:8207- 11972
Sequence
3765 bases(100 bases per row)
ACGTGACGACCTTAGTCGCCTCGTCTATCGGGTTGGTCACAATATTCGAGACCAAATACCGTGCTCTCTGCGCGTAAGCATGGACATCATGCTAACCCTG
CTGTAGGTCGAGGAACTCTGCCCTCGACCGGAACTCGTTTTGCGGGGGCTCAAATGCTTGTCTGAGCTCATCCTTGAAACCTCGTACGTGCTGAAGCACG
TAGGATCAGAGAGTCGGCGTCCATACGCCCAACTTCTCGCTCGTCCGCCAAGGCATGACATGGCGAACGCAACCTTGGACAACGTACGACGTCGAGCCGC
AATGGCAGTGTCGAGTTCGACAAGCTAACGGAGGAGAGGCTCGCCCTCTCTTCCGACATGTTGCTCACGTTTAGCTTCAACGACTGTCCACGCGGTGTCG
TCTCCGACGCCACCGTGGTAGAGGAAGCAGCATCACGCTGCTCCTTCATGATAAACCCGAGAGCAACACCATGTTGCTCTGTCGACGATAGCGTACGCAG
CATCGCAGCTACTGCCGCCTCCCCAATGACTGTTGACAGTCGTTGGAGTGCCTCCCACTCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGA
GTTGCAGGCGAAGTGGAGCTTTCCATGGGCACCTCCGCGCTCATGAAAAGGTTCTCGGCCCCTCGTTCGTACAGCTCCGTACCAATTTCAGGTAGTCGGT
CGTTGGACGGACTACAAAGTGCTTCCAGGTGTAATGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTT
CTTTTACTTGAGTTAAGTATACTCGAGATCCACAAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGCTATTT
TTGTTTTATGTTTCTGACTTCCTCAAAATGTAATATTCTAAACTAGGAATCTGCCAACCGCTGGTTGGTAGGATTCTGCTAACATGCAATTCACTCATTG
GCTAAAAGATGCTGCTTTCAGCCAATTGAAATCCTAAATGTGCATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGGTGTACCTTACACC
AAGGTCGAGGAAGTGTTCAAACCTCTAACAGACATCGCAACAAGTGACTGTAGCCACTTGTGCGTGTAACCCCGTTACATCTTTCTTCTATTCCAGGAAG
AATGCCAGCGCTGGAAGGTCGTCGTGAGACTCTTGTAAATAAAGCGACGAGAGGGAGTTGCTGACAGGGGTGGTTCGCGCCTAATGAGATCTTGATATAT
AGAAAAATTGTTTTAAAATTTGTCCTGTCAAAATTTGTCCCATTGTGATACTATACATAATTGTAGTGTTGATCTTCCGGACGGATTAACCAGTTAATAA
GGGTTTTGGGCGTTGGATTTCGGTGCATCTTTTTAATGCGGGATAAAACGTGACCAAGGGCGGATAAAAGGGCGTATTAAACGGAGTCGCATTAAACCGT
TTTATGTAGGTTTTGGAAGGCACCCATTAGGCGCCTTCCAAAATGGAGTATCCGTTGAGCCCAGAATCTCCATGCGCAACGCCTGAATGCGAAGGTCCGG
TCGAGTTCGAGATGGAAGATTTCCCGGAAGAGCGAAGTGTGATTGACACGTCTGTCTGCGCGATGGAGCTCCGTTTAGATAAGGTGCAAGTGGAAGGTAA
CGACCTTCTATTTGTGGAAGGTCTCGTGCAAGGGCGACGTCTGAAAATGTTGGTTGACTCTGGAGCGACGCACACCATTGTGCGACGCGATCTGCTAGTG
GCTCCTGCTGGGACGCGGGAAGAAAGGATTCAGGCGAAGGAAGACTGTCCGTGACTACATCGAAGAAGTTCACGGTGGACATGACGGTGGAAGATCGCTT
ATGTCCAGTCGAGATGGTGGAGTGGCCCTTACGACAGGACTTTGACGGCATTCTCGGTAAGTCGTGGCTTCGTCGTGAGAACCCCGATATTGACTGGGCG
GCTGGCACTGTGTCGTAGCAACACCCACCTCGCCGTAATTTGCCTCGAGAATGGACACCACCTCCGGGTTCTAAACCGGAGATCGAATATGTAGACGCGG
ACGAATTTCAACGCAATCTCAGGACCGGGATGTAACGGATTTTCCCGAATACAAGACCTGTAGGAAATAGAAGTCCGGTCAGGAATTGGTTGGAGTGCCT
GAAAATAGAAGTCATGTATCAAATAAAAGACCGGACATTTATTTTTTTAACCCTTTCGTGAGCAAGTCACTAAGTATACTATACAAACTCAAGGTACTTG
AAAATCAAAGGGGCATTCTGCTCCGTTCGAGCATGTAGCCATCCCTGCCTCTTGTTGGGTACACAAATGGAACAGGGCAAAATGCCCCCAACGGGCAGGA
CAAACCTTGCGTCTTGATAGGCCAAAACAAAATCTTTATGGAGGGTCGCCTCGCTGAAAGGGCGCACGCGATTGACTGGGGTTGCAGAGGAAACGGCACC
TTGCTTCGACGGAAGCTGATCTGGAAAGAGTTGGACTATGAATATCTTCGCTATATCTTACGAGGGATGCGCTTGTTTGAAAGTATCCGAAGGTGTCGTC
GAAGGTAGTGCCAGGTTGGCATGCACGTTGTAGTGGGTACATGTAAAACAAGTAAAAGGCGCTTGTTGTACATGTCCAAGCTTTCTGCCAGGTGGGGCGA
CCGAAGGCCACGATGTTGCCGTGTCAGGCTCTATTGGTAACATTGATGAACTTGAGCGAGCCCTTATCCTGAAGTCTACGCTACTCAGTGTGGACTACGG
TTGGTCAACAGCTGCGATGAGCTGAACGCCCGTACGTTGGAGATCGACTGAACGAACCTGACCTGTTAGGGGATATACCTCCTGCGCCGCTCAAGCCTGT
GCAAACGTCGACAACGATCCGTCCATCCGACGGTACAGCTCCCGCTAAGCTTGCACGTCTTCACGCAGCTCGTGTGGGCATGCTCCAAGCCGATATTTTC
AGGGCATGACCTATCCATATAATATCAAATCTACTACTATTTGTGCTGTAAAGCTTGAATTTCTGCTGAACACCACTCGGTCATGTACACTAACACTGCT
GTGTTGCGTCATGGTGGGAAACGGTGCCGACGTCGGATACTATGAATATATATGTACTTCAATGTGGGCACTCAGTGAAGAACTGGTGCCAAGCAAGCAA
TATTTGTACGATCCAAACTTCTACGTATCATTTTCATTCACATTTACCAGATTTTTGCCTAATACCATTGCGCTCAATAGTAAATCTACCACTCTCACGA
CCCAAAGCATGTTGGTAAGAGTGAAGCACCATGTCGCCATTGCTGAAGCACGATGTTGGCGTAGGGTTCGAGTAGCGTCCCATCCATGCTAACGTCGAGC
GTGGCGTCTGTATCTAGGTTCGGCATCATGCCCCCCTTGCGGTCGTCAACCGTGGCGTCCGATCAGCGTGCCCACCTTGCCAGCTCCGAGCGTGGCGTCC
AGGTCAGGGTCCGGCATCATACCCTCCCAGCGTGCCGACCGAGCGTGGCATCCACGTCGGGGTACACAAACGTGCCGACCATGCCGTGGTCGCGCGTGGC
GTCCACGCCGGGTTCCGCCATCGTGCCGTCGAGCGTGGCGTCCTTGTCGGGGACCGGCAGCATGCCCTCCGTTCAGTCGTCTGCCGTGGCGTCAACGCCG
GGGTCTGGCAGCGTGCTGTCCGTGCTGGCGTCGAGCGTGGCGTCCACGTCGGGTTCGGCAGCATG