Description :
From Genome Similarity Track
Location :
Scaffold_180:8207- 38632
Transcript NameFunction/comments
Phypl_g4797conserved hypothetical protein
Phypl_g4798pyridine nucleotide-disulphide oxidoreductase, putative
Phypl_g4799hypothetical protein PHYSODRAFT_532994
Phypl_g4800conserved hypothetical protein
Phypl_g4801hypothetical protein
Phypl_g4802hypothetical protein PHYSODRAFT_532485
Phypl_g4803conserved hypothetical protein
Phypl_g4804hypothetical protein
Phypl_g4805hypothetical protein
Phypl_g4806hypothetical protein PHYSODRAFT_307593
Phypl_g4807conserved hypothetical protein
Phypl_g4808hypothetical protein

Sequence
30425 bases(100 bases per row)
GTAGGACTTGGGCGCCGACCTCGATGCTGGGCTACATTCCGCTATTTGCAGACCAGCACGAACGCCCCCGAGAGCCACCATGTCCTgtagtagcagcagc
agcttgaagccgcGCCGCACCGTGCGTCGCCCGCTGCAGTTCGCGTCGCCcgccaaggagcagcagtaccGCGCCGAGATGGACCAGGTGCAGCGGTACA
TCTGCGCGCAGGTCGGCGggctcgacgacgccgcgaGCCAACTGCTCGGCGTGCACGACAGTCGCTCGCGCAGCTACTACGAGGAGATCCAGGACTTCCt
cgagcgcaagcagcagttcgagcagcagcagcagcaacagagcgccgagcgcgtgctcatCGACGAGTACctgaacgagctggaccCGAGCCTGTTCGTC
GAGTGCGCGCCGGCCACGTCCAAGCGCCTCGCGGTCGCCAACCTGCCGGCGCACAGCAGCTACATCCGCCGaaagcaggaggaggccatGCTCACCCGTC
TGTGGACCAAGTACCAGAccgccgaggccgagcgctGCGCCGAGCCCTCGATCCCGTGCGGCGGCTCCCTCAAGCGCCAGCGGGTCATGTGAACAAGAGC
AGACCCCATAGAACTAGACGCGGGGGCTTGCCAGCGGCGGACACCCGCCGACCAGCAGATCCCGCAGTATTATAGCATCCACCGAAGTAATTTATCGCCC
ATGTCCACGAAGCCTTCTTTCCTGCCGTAAACGAAGGTGATCGGACCGTGCCGTCAACAGAGCATCCAGCCGAAGGTACGGGATCCCAAAATGCAACAAC
ACCCACGACAGAGCAAGAACTCCTCTTAAGAGCGGCAATTCATGTCAATGGCTCAAAGCCGCTTGAGATACCCACAACAAGAAGCGTATCGCCTTCGCCG
GGCAAGCTGTAGCGAGGAAGCTTCGCTTGGTCAGAAGCGATTTGCCATGCGATGCTTTGCTGATTTCGGATCTATGATTACGAGTTTTGATATCTTGAAG
CCCACGCATACTTTGTTGCCACGCAGCAAGGCCTGGATATTCTTGAATGAGTGGTCTGTACGACCGGTGAGCCACACCGCGATGGCAGCTCCTGTTGTCA
TCTTGTAGAGCTCCATTCTGTGCGAGATGCCCGAGGctcgttgtacatgtagtacatgtacacttATGGTTGTGTAGCTATTTAGCTTTATTCCTGGACC
CCCCCCCACCATGTAGCAAACGGCGGCGTTTGTTTCGTGAAAACACTCGGCCTTTCTTCATGTCAACGGCAAAGTAGGATAGCGACTCTCACGGCAGTAT
CGCCGCTGCTTCAGATACAGTTTTAAATCTTGACGTCAGCATGCTGGCGAACCGCTTCGGCGCTCGCAACATGATCCTGTGGGGCATGGTGGTCATGTCC
ATCGGCATGACAGTGGCGTTCGTCGCGGACGTGTCTACGGCGATAAGCAAAAACTCCGACGCGTAGTGGAAAACGTCCATTGTCGAAGTTCTCGTATGGC
ATCCTAACTCTACGAGTCCGAATAGGCATCTTCACAAATACTAGTACTCGGGTTTGGTAGGCAAGCCGGCGCATATCAAGGGTGGTGCACACGCAGGCGT
ATCGGTGCTGTTAGGGTTGAAGTGGACAGTGCGTGAGTTTCAGCAACATCTGCTATAATACGCAGCACTTCAGCATCTCACCGAGAGCCCTCTTGGCAGT
CCTCAGTGCAAGTGTACTTTATTCAATGCGTAGGGTGGACGTCGGACTGCACTGCATTGCCAACGTAGTGGCCGTACCTACAGGGTCATCTAGATGCACT
AGGGACTTGAAGGCAGCCAAAGCGCTGCAGGAAAAACGAAGTTCTTGCGAGCTTCGTCATCGGTTGGTACACTACCTTTTTTTTAAATATACATGCATCA
TTCGTCAGATTCTAGGCATTACAATACTATCTGGAAACTACCACGTCAGATTTTGTGTGATTGTCAGCCGCTTCGTTCGTTCTGGGGTCCATAGCAGCGG
ACCTCGTGTTCCTATCGGCTGACTGATCACCGCAACTCGATTCTCACCGTACCTGGGCCCTACGCGAAGAAattcctgctgcttcttcgactcCCATAGC
AGTGGTGTACCAACAGTAAGAGTATCTCCACCGGTAGGTCTCAACGGCGGATTTATCCCAAAAGTGGCGTGATTGAGTCTCGGCCGAGTTTCCAGCGGTG
GGTCTATAAACCGAGTTTTATGGTGCATTTTACAAGTAAAAACATGGTACCGGTTGGGCATGCCGTGCATTGCCCGGAAAGCTCCAGTATTCCCTTTTAG
GTTTTATCGAAAAAGGCTTACTAGTACATATCGATACTTGAGCTCAATCTACTTGGGAGAACTCAAACACCTGTTGTAGTAATTTCTATTGCTCATTCAA
ACGTCGCGCGAATGTTGCTTCAGTAACATGTTGCACGCATGTATAATTATCCAGAGAACATCCGCGATTGTGTGACTTTTGCATTCAAAACGGGGTCTTA
TTTTAAGATTCGAGATACAGCCGATAGGTCTCGCTGAAGTTAAAACCTGCGATAGGCCTGCCGCTGGAAGCCTTAAAACTCGATCGAGTCTCAATCACGC
CACTTTTGGGATAAAACCGCCTTTGAGACCCaccggtggagatgctctaaTGAGGTGTAATAGTTCCAACCTGTTTGTGCCCAAGTAGTTTGCATTGACC
GAGTGTTGCCTTCTCGCATCCGTCGGACTCTCAGGGTCGCAGTTGCGTTCAAGTAGATCACTCATTCCATCAGCTTTGTGGCACATTCGAGTGATCGGTt
ttgcttcttgctgtgATGACACCAAGCTGAAGCCTGGAATCCACTACACTTATTCACGTAGAAAATATCATCGCAGCACCAATCCGCAACGCGCTACGAT
TGTGCAGGCTACGCTTACATCTACCATCGAGCCGCACCTATGgaaaacacacacacacacttATAGCACCTTCACCAGTGCGGCTATCCGGGCGTTAAAG
CCAAATCTGGCAGAAAGTAGCTTTGAAGCTGCCACCAATGCGGCTATCCAGCTGGTAATAGAAAAGGgtattttaatattaaaatagCTCATTGCCAATT
TGAATTCCATATTTGACATTTTAATAGCCGCAGCCAAATCATTCAATGCTTCACCAGTACTGGCTCGAAAATAGCGGTGTTGGTGAGGAAGCACGCGTTG
AACGGCTAAACTAAAATAGCTATGGCTCTTCCGTGCAGTTATTCTCAGGATAGAATAGCCACTGGTGAAAATGAGACCGCGTCAAACGAAAGTATGCTTA
CGAACctaagtacgaatcgcgatttaAGCACACCATCGGAAAGACGTGTGTCTTGCGCATATTTTGAGCCCTTGGTTGCTCTGAAATATGCAATACTCGA
CGGACGACGGTTGCTCGAAAAATATATCTCCATTTTTGAGCCTTCAAATTATCGATATGTTTGGTGACGGTGTGGTGGCAATACTACCTCATTTTTTATA
ATCCGTACATTATCGGAAATCTTGTGCAAAAGGGAATCGTATCGTAGTGTTATTTAGCTGTATTCGAGTGAAAGACCCTTGATTCCCTATTGGGTACGAA
ATCGGTAGGGTCATCTTTAGAGGCGATTATCTCGATAACTCTAAATGGTGCGGTAGGATCATTTTGTTTGACGCGGTCTCAAATGATCTCAAATACGCAA
TTGAAGCGGTCATTCTTCATTTCTCCACGGATGAACCACGTCCTCTCAAGAACAACGACCCGGACGATCACCAGCCGAGCCTCCAGCCATCTCATCAACT
CAACATGATGCGCATTGTGAACGTCGGGGGCGGCCAGGCAGGCATTAACTGCGCCCAGAACctggccaagacgctgaccGAGGCAGACAACACGGAGGTC
TTGGTGCTGGAAAAGAGCGGACACATTGGGATCTGCGCGCGCCTTCGTCGATCCCGACTACGCCAAGAATACGTTTGTCCCGTACGAAAACGCCATCCCG
AAGACGTCCTCGGGCTTCGTCCGCATCGAACACGCCGTGGCCACAGAGATTTCACCTGAGAGGAAGGAGATCTCGTTCCAGACGATCGGTGCCGATGACA
AGAAGAACACCAAGACGGAAAAGCTGAATTTCGACTTCCTTGTGTTGGCCACAGGTAGCACGTACACGGTTCCGATCAAGCACGACCCGAACGACTACAG
GCGTGCAACCACCGAGGCCAAACTGCAGGAAGTTCGCTCCGAGATTGAGAAGGCGGACAAGATCCTGATCGTCGGTGACGGAGCTGTTGGCTGTGAGATG
GCTGGTCAGATCAAGGCCAAATACCcagagaagaaggtgacgatCCTCGAGGCGCACAGCGAGCTCATTTCCCGTAACAAGCTGTCGGACAACTTCtact
cgaagctgcacgccgcCCTGGACGCTATGAAGGTGGACATTATTCTGGGAGAGCGTCTCGCTGAACGCCTGCCCGGCAACTCTTTCGAGAAGCGAACGCT
CCGCACCAACAAAGGTACGGAGATCGAGTCCGACATTCAACTTCTTTGCGGCGGCTTCCACCCTGTGTCGGAGCTCGTGCAAGACATAGATCCGTCGCTT
ATCACGGAGCAGAGGTCGATCAaggtgaacgcgctgcttcagctggaCAACGAGAAGTACTCAAACATCTTCGCgctgggcgacagcagcaaccacgaGA
CGCCCAAGATGGCCTTCTNTGATCCTACCCGTGGGCACGGGAGGAGTCTCTCAGCTGCCTATCTGGGGTGGTGTAGTGGTCGGCGACTGGGTCACTTGGA
TTTTCGAGGtcaacatggctacatcaCGTCCGGTGATCAAGGCCAAAGACTTCATGGCTGGACGTACCTGGGGCAGCCTCGGCGCCACGCCCCCAAGTAA
CTTTGGCACGGACTATACGACATATGAAGTCACAGTTCAGATGACAGATACAGCCTAGCTACGAGCATCGAGCTTCACGAGACGAGAGTCACTTGCACCT
TTTTGAATACATGTATCTCCGCTTTTTTTTAGATCCCTTCTTGACGAAGACCTTCAGCTACAAGGTTCACATCTGCACGAGTTGTTCTCTTTAGTGAATC
GCCGCTCGATCACTTGGAAGTTGGCGGTAGACTTTGGAGCGAGCTCGGAGTTTACCAGCGCCGCCGGTAGCGCTGTGTTCAGGAATCGAAAGAAGCTAAA
GGTAGCAAGCAGGCTTACTGGCACTCCAGCAGAAGCATGTTCGGCTCCATGATCTTACTGCTCGGGGTTTTCAACTTACATGTTCGTTCGGGACAAAAGC
GCCGATGCTGGCCCAAATCCAACCCGCTGATCAGCCACGTGAACCAGTCGCCCATGACAATTCCTCCAAACACGGGCAACTGCGAAACGGGCCCAGTGGC
AAGATCATCGCCTCTGTCGCCACACCACCGAACGGCTTGGTGAAGCCTGCCTGTTTCTTGTGGATCACTGCTGCGAGCTCACCAGCAAAGAAGGAGGCCT
ATTCAACGGCCAAATAGCCATCTTTGTTGTGGGGTGGCTGCACATGTTCCCCACGTGAGCGCACTTGGTACCTTCGAACTGTAACTTATCATTGATTTTG
ACAAACCCGCGATCGATGACCAGCGACGGATCCATCTCCTGTACCAGCGTGGGTACGGGGCGAAAGCTGCCACACAAAAGCTGGATATCCGATCTCCGTT
CCCTTGTCGGTACGCAGCATTCGCTTCTCGAATCAGTTGCCGTTCAGACGCCCGGTCAGACGCTCGCCCAGGGCCACCTTCACCCCACGCTTGTTCAGCG
AGTCGTTCAGCTTCACGTAGAATTTGTCCCGGAGGTTGTTGCCAGAGATGAGCGGTTGATTCGCGTCCACGATCATCACCGACTTATTCGAGTTCTTTGA
CTTgatctccgccgccacctcaCAGccgacggcaccaccaccaaccaCAAGGATCTTCTCCGCCTGCTCGATCTGACCGCGCAACTcttgcagcttcacc
tccgtcgCCGAGCGAGTGTATTCATAACCGCCAGGCTTGATCTGGACCGAGTACGTGCTACCagtggccagcaccaggtaGTCGAAGCGAAGTTTTTCCC
GTGGTCTCactcttcttgtcgtcgcccCAGATCGCATGGTACGATACGTCGCTCGTATCGGCCGAGATGTGCGTGGCCACTCCCCGTACAATGCGGACGA
ATTTTGGGATGGCATGGCGTTGTCATAGGGGATGAACATCTTGTTGGTGTAGTCGGCATCCACGTAGGCGCGCGGGGCACCGACGGCATGGTAGAAGAAG
GATTTTTTCTCGATCACGATGACCTCCGTTTTATCGGACTCGGATAGGTTCTTGGCTAAGGCCTGGGTCACACGGATGCCTGCCGCACCACCTCCAACGA
CCAGTACACGTGTCATGATCGTCAAACTGCTGCTTGTGTTGTTTGCGTGCACTCGGGGCATTCGCTATTGAGGAGTGCGTCTGGTTGAGTTGATTGAGTT
GTGAACTCGTGCTCTGTTGACTTGCTAGTCAAAAGCATATCACAATGCTAAAGGATACTACGCAGATAGATGCGTGGCAATCGCTGCTGGTTATACGGAG
TTTACCACAGGATTTTCGCGATAAACAATGGCCCCGGAGAGATTGTACCAAAGCTATTAAGGCATTTGCTTCCATTCATGGGAAGAGCGTGGTCAAGTTG
GTCACAACAAACGCACATGCGGCGAATAGCCCGCGTATCTACTCGGTAGGAGCTCAGGTAAATTCTTTCAAATAATACATATTCTCTGTTTCAGGAATAT
CCGTCACCATCAATGGGCTCCTttgtcgcgcagcttgaggtAGGTACATACATCTTAACTTGATCGAGTCTCAATCGTGCCACTTATGGGATAAAACCGC
CTTTGAGACCTaccggtggagatgctctaaAGAGGTACAATAGATGTAGTTCCAAACTTTGTGCGCCCAAATAGTTTGCATTGACCGAGTGTTGCCTTCT
CGCATACGGAGCTGACATCTCGGAGAAATTATTTCACGTAGAATATATCATCGCAGCACCAATACGCAACGCGCTACGATTATGCAGGCTACGCTTACAT
CTACTATCGAGCCGCACTTATGAAAAAACAGCACACCCTTAGCAGAGAGGCGCCTACCTGCCAGGTAGGCTACTAATGAGGATAGTGCAGGTCGCTACTG
CATGGGTGGCAGTTTGGTTCCTTGTTCATTCACATGCGGTACAAGTTCTGAACCACACTTTTGACCCAGCCATGCCATTGAATCCAAAGCGATCGAAACA
GGCACTCATCAACTCGTCGATCGTTCGTTAATCTGTGTGACTAATTTGCTACTTGGCCAgcacattttttttttgcttcCGTCAAGCCCGAAACCAACTG
AGTTGTAATAATCTGAAAGGGAGGATACCCCCCCCTTTCAGATATATGATTGGCTCCAAGATTTATTCCTGGCTTTTGTTTTTCTTCGCATGGTTATGTT
GTTATTATCTGGGATTCAAAAGGCTGCGGGAATCGCTCCATTGGTACTCTAGATTGTACTCGTGTAGATCTAGAGATACATCCCATAGGTCTCGCTAAAG
TTAAAACCCGCGATAGGGCAAGCCTTAAAACTCTGTTTGCTTTACGTTGGGAAGTACCGTACCCGCTCTCAGCTTGCGCTATTACACATATCTAAGCAGA
TCCAAGATCATCTTTAAGATGTGCAAGTCCTGCTTCCAGAACCCTGACTCAACGGATTTAACCCGCTCTACTCGTAATACACGTATGTATTATGTGGAAT
CATAGCAGTAAGCAGCGGACTCAGGCCCAACTCAGACATCAAATGCAGCGATGAAGACAATGTGAGTGTTGATACAATGTGGTAGGTGCAATGAATTTCA
GGACACATGCAGACTGCGTCGTGTGTTTGTATGGTACCGGTATGTGGGTTTTGTACCCTTTACAGTCATCAAACACAAGTGCAATGTAGTGAACGAGTAG
GAAGGTAGCCACAGCATGCGCACGGGCTTAATTGACAACCGATATATATTGTACCTCGCAGGATTGACTAATTACCAAAAAATATGCTTGTTCAGTTTGC
AGCTTGAGTACCTAACTGACAGATTGGGGGACCTTTAAGTGCAGCAGGCGCGGGTCCGTCGCCAGCGGAGAGTTTTCGTGTTGTTTTACAGATCGTTGCA
CAGGATCCCGAACGGTAACCATTATTATAACCACCATTCCTTCCGTTGCAAACCTACATACAAATATATAATATAAATATACAGCTTGAAGGCGACACGC
CTCAGAAACACAAGTGTAGGAAGTCCACACGTTTGTCCGAATTCTAAAAGGGTTATTTTAGGTGGTAATGATATGTAGTTATCCTCCTCGGCGACTCACC
CGTTCAAGACTCCCAATATACAACCCATACATGTCCATGGTTGTTTCATCCAGTTCTTTTGGTAAACTACCATGCTTCAATCTGTAAATTAGACCATGAT
ACGTGCTAGCATACTCCTTGCTCTAGAGGAGGGTGCTCGAATTATTTAAATTGTTTTCGTCCATTTGCAGTTTGAAATTTATGTACAAGTTTCCGGCACT
GTAAAAACATTCTGCGTGTCTTTGATTTGATGGCACTGCTCGCGCACAATGCTGGTCAACTTAGACAACCCGCAATAGTCTAGGTCATGTTTCAACGGCG
TCCACCAATGGATTTCTAAATTCTAAACCGGCAAGACTCCAGCGCCTACACTTGTAGATGCCAGCAGCCACTTGAATACACCAATAGAACGGGGGAaccg
acaacaacaacaacacaaAATAAAAATGCCATCACAAACTACCATGTTCGTCTTTCTACCGGGAGAATTTCACGTGCTGCAACAATGCTGAAAGTGCCGA
TCGCCGTGCTGCCAGGTGGCAGGTTGCGTGCCAGTAATGATAATGATGCCGACACATGGCAGGCAGGTCCGCGCAGTCTGCAAATGACCAAACTGTAATC
CCAGGCACGGATTGCGATGGTTACCTCCATAAACGCATCCTCAACAGCATTTACCTATTTCCTTGCACGATATATCCATTCTCACGTCGCCGCACCGCGC
CAAAACTCTGCTAACGCCAAATCTCAAGACGCCTGGggcagcagaagccgctcGACGCCTCAGCGAaggaagcgcgtggccagcagcagcatgtacCATG
GGGCGGCTCGGGACCGCGGGGACAAGGTGCCGTCCTCTCCATTTGCCCCCTctaacccccccccccccccctctaACCTTATTTTTCGCTTCCTGTCAAC
GTCGATGCATACATCTACTTTCCGCAAaagaagcgccagcgcctcaCGCCCCCGCCCAACGAAGTCTGGATGGAGGCCATCATGAGCAAGGGCAAGACGc
cagatggctacatcccCGTATCGGCCGTCACGGCGAGCGGGGTGGCcgcgtcggctgctgcggcctGGCAGGGGAGCACGCGGGACTGGCCCCAAGCGTC
GGGGGCCCAGGGATCCATGCACCAGTACCAGCAGTACGCTACTGCCCCGAACTATCAGGGGAGAGCGCCggacagcgcagcagcttacCAGGGGAGAACC
ATGGACGCTGAATACCAACGCAGGATGATGGACGGAACGCCGGGATACCAAGGGAGCGCAGTGGACGGACCTACCGGCTATCAGGGGAGAACAGTGACTA
CTTCTACTGCGTATCAGGGGAGAACAATGGGGAATTCCACTGGCTATCAGAGTAGACCGATGGATGGACCGGCAGGATATCAGGGGAGACCAATGGACGC
ACCTGCAGGTTACCAAGGGAGAACggccgctggagctgcggccTACCAGGGGAGAATCGTTCAGGACTCCACTGCTTATCAGGGACGAATGGTGGACGGT
TCTACCGGCGGCAAACTGTATCAGGGCAGTGTGGCAGAGACGTCTTCTTCGGGGAAGATGGCCGAGGACTacaagagagagagaaagcTGCCTCCCAGAg
tggaggagatgctgcgcgagcaggtGAATCTGGACGAGTCTGTGCTGCACGATGCGTTTGCTGTGGCGATGGAGGACTTAATCCCGGAACAGGAAGCCAA
TTTTGTGGCTAAGGGACTGTGCCACTTGTGTGGAGTGAGCGAAAACCACTATGTGCCCGTGGTGAACTTTTGCCCGCATGCGGACGAGAATCACTCGCTA
TGTCGGGAGCACCTGCGCAGCGTTTACAGAGTGCGGATGGAAGCTTTATTTGTCGGCAGGAACGGGTCAGCACCCAATCGGCGATTGCTGCGCTGTTTGA
TTTGCACGGGCGGATGTCCGTGTACCATGTGCACGGCGAAAAAGGAGCAGGACGTGCGGAAATACAAACGTTATCTCCTGGACACGCTGCGCCGTAGCGG
ACAGGGCCCAGTGAATGCAGCGACGGACGACCGTGCTACTACTGCCGCTGCGACGTCCGTTGCTACAGCGGTCGTTGTATCGGCCCCGATCTCCGAGGGC
CGATTGACATATGGTAGCGCTAGCGACGGTCGCCAATACGCACAGTATCCACCCACACCACCAGGTGAAGGGCGTCCTCCCATTCGGCGGGACGGATTTT
CTGCTCGCAGTTTTGAGACAGACAAAGCGTATGAAGGACGCAGACAAATACCGACTCAGAATTCCAAGTATGGGCAATATCCGGCGGACGAACGGAACAT
CCGTGATGGTTATGTCCCCAGCACGCAGGCACAGTCAAAGTCGCCGTCTCAGTATCCTCCCGTTCCGAAGCGCGCAGCCAAGGATACGCCTGCTGATATG
CTCTCTGTAATTGCGAATAGTGCGCAGGCTACTGATcctcgagttgctgctcgagttgcGTCTCCTCATGTTCACCAAGGCTCCGCAGAATctccatcag
cagcaaccgtTTTGAATTGTGCTGAGTCTGAGAAGTCTCTGGTCGAGCTACTAAGTTCGTTAAATCAAGGTGGAACCCCCGCGAGCTCGACGGCAATGGA
TGCCAGCACCCAGTCTAGCAAGGGCAGTAGTTACCGCCAAGGTGAATCGCTCTACGCTACGAATGGGATTACAGCGAAGAGCGAGAACAGTGGAAACACA
CAAGGTTCTGACGATACTGAAATGGAAGCGTCTCCTCGGGCTTTCTCTGGCCGTGGCATTGCTGACCAAGCAGATAGTCCATACCAGGATCAATCTTCTA
CTAGCTCAAACGATTCGGGCGATAGCCCGCGTCGGGATCGCTCGAGTGTTGGCTCGCGGTCTGTTGATGAGGCCTCTGCACGGAAGCAGAAGGCTAGTGA
AAGCGACGTCGAGGACAGTGCAGCGCTACGTGACTCGGATGACATGGCATCACGAGATGATTATCAGGTTGTGAACCGTGCCGAAAGCGCCGTGGAAGAA
CAGGGCAGTGAAGGTAAGCACCAACTCCAATCCGAGGCGAGCCCAAATTTCAGCGTGAAGCCCGACGACCGTGGGAAAGAAAGCTCACCCAAGGTCGAGA
AAAATGAAAACCATTCTGCGTCGACTCCGCCACCGCATCGTGGACCAGGGCGTCCACGCAAGCATCCTCTTCCTGGGGGATACGTACCCCCAGCGAGAAA
GAACGCACAAAAAGTTGCCACTCCACTGAAGAGGGGAAGAGGTAGGCCCCCCAAACGCCCCAAGCGAATGAAACAAGATGACGAAGAGACGGAGGACGAA
AGCTACCGtgaggaagatgaagaggaagacgacgagggAGAAGGTGGATCGGACAGTGAACTGGACACGAACTTAGATTTCTGTGAGGTTTGCCAGGGCG
CTGGCGATCTGGTCTGTTGTGACAAGTGTCCGCGTTCCTACCACTTGAAGTGCCTGCACATGACGGAGAATGACCTCCCGGAGGGCGACTGGCAGTGCGA
CGAGTGCAAAAAACCGTCACGGTTCGACGCGTATTCTGCTGCGGTGGCGTCGAAGCAAAGCTTGCTGGACAAGTGTCTGAAAATCGTCAAGTGCATGAAG
TCGCATCCATTTTCAAAGCCGTTCCTCACGCCCGTGGAAAATGTGCCGATGTACACGAGGGTGGTCAAGCAACCGATGGATTTGTCGAAGATCGAGaaca
agctgaagaagggcGCGTATATCGTTGACAGCAACACGGTGGCGTCTGGCGTTAAGGAGTTGGATTGTTTGCACTTTGCCAACGATATTCGACTCATGTG
GTCGAATTGCAAGCTTTTCAATGACGACGGATCGGGCATCACGCGTGCGGCCGATATCCTGTCGGCGGGCTTTGAGCGCCTGTATAAAGAGTCTATTGAG
CCGCCGTTGAGTTCATGAGTTGGCTGTTGACAGTCGAGAGCATGGGGGCTACAGAGCCACTTTTTACGGTGCATCGGAGCAACTTGAAGTGGGTCAACAG
CGCCCGAGAGGATTCGTATGGCCATCTGTGACGTTGGTATCTAGGAGGGCGTTCAAGTAAGTCGCAGTGTCTTCTGCGGAGCGCAAAATCGAGATGATAA
GTATGAGTGCGTACCATCCGCTATTATTACTTGGCTTTTGTTCTGCTACGCTGTTCTAAGTTAAGCCTTGCAGTTTTGGGGACTTCAGGACGAGGGACGC
GCAcatttaaaaaaaaattctGTCGGTCGTGATCGGGATGGAGCTCGCTTTGGACGAAGAGGGCGCCCAGGTGACGGCCGTGACTTCGTACGATCCGAGC
TTCCCACCGGTCAATATCTTGGACGGGTAAGGATCTGTCTGCTACTGCACCTTACTGGCAAGGACATTTACGACGTGGCTAAGCCTTTTCCTGGTTTCGT
GTTCGAACAGAGAGCACTCGTCGAAGTGGGTGACAACAGGGAGCTTTCCCCAAGAAATTGTGGTCCAGCTGGCAACGACGGCCTCTGTGGTTCGTGCCAA
GATGTGGACTCGAAATGTCAAGGAGGTGTCTGTAGAATCCTGCAGCGGCCCGACACCTACGAAATGGGAGAAGCTCTTCGACACCCGTAAGCAGCAACAG
ATcactactacatgtagtatttGCTGCATCTTGATCGTCAGCTAACCTTCGTGCGTTTCGGGTTGCCAGAGTTGAAGGAGACCGACGGTGAGATGCAGAT
CGTCAGCGAGAACGTCAAGCCGACCGATGCGTCCTTCATTAAGTTCAAGATCCTCTCCGGCTGGGGCGACTTCGTGATCGTGCATCGGGTGAGCGTGGAA
GGCTCCACCTCACGACGATAAACAGCTCTATATACTCGCTGCAAATGCATCGCTTTAACCATGAGCGtccgtcctccttctctACTTCTTCCCGAAGAAC
GACGTGAGCGACTTCATTCCGGAGCGGTCCACATTGGccagcttgctcttcttcttggcagcgccagcactgGACGGCGTCGGTCGCTTGGCCCCGTTCT
CGGGGGTCTGACGCCGGTCAAACCGCCTGAACGAGTCCTGCGgccctccagctgcttggGCAACAGCCTTCAcagcctccacctccttcttcacccTACA
GCAACACGAGCAAAAGGCCCATCAGCATCACACAGTACAACTTCCCTCCTAAGTATCTCTACCGTCACGTACTGGAACTCGGTGCAGAGCAGGTCGATCC
ACTCGTCGGCCAGGTAGTTGCCCACCACGTCGATAGCTTCACGGTAATGCCTTGCGACATCCTCCTGGGTCACGGTACTtcgcttctgcttcttctcctc
ctgcttaTAACCGGGCAGATTCACCTGTTCATGGACCGCCAAGGCGTTCGCCGCCTTGTTGgcggcctccacctcctgcttggccagcacaGCCGCCACC
TTGTCCACTTTAACCCTCAGCCAGCTCGTGACTTTGCTCTCGCTGGCCTTGACGTAGAGATTGTCGACCCCCTCCTCCCCTCCGACCGCCTGCACGTCGC
ACAGCGTCTCGACCGTCGCCTGGCTCAGCgtcgagagctgcagcagccacgtgTTGCCGTCCCGCGCCAGGAGGTCGTAGACCGacgagaagcgcgtgcg
ctgcgtccacgcggcgtccagcagcacgaagagcgcgtcgACCGGCGAgaagaccatcactcctccgtcctgcagcacgcggttgCCCACGAaccagctg
cgcgcgccCTCGAcgggctgcagccgctgcagctccaggagctggcgcttgtCCTTGTCCAGAGCCAATTGTCGCGTTCGGGTGGACTCCGCACTGGGGT
GCGAGGTCCAGGACACCGCCGAGAGGAGCGGCTTGTCCGTTGCGTCCGAGTGGAAGCGCCCCAAGTTGACGctcgacggcagcgctgACGGcaccagcgc
gagcagcgtgcGCCCCATTTTGTTGCCGGAAGATCGAGAGAGTGAAGGTTCCcgccaaaaaaaaaacttgaACCTAATTGATGTGCATTTGGTGTGCGTt
tttggcgccaaaacgGTTTGGATGCGGTCAGTACCGAAATCGCTTGGTCGAGGGCGTCAGTATGGGGAAGAAAGCTGCGCCCAAGCAGAGCTCCCTCATG
TGCGTCGGGCGCTGGTCGtgtgcagcgcgcgctcctgTGTCTGATCGCTCGCTCGTGTTGCTATTGCCAGGTCGTTCTTCGGCGCGggggcgtcgacgcc
gccggccaagaagcggaaaCCCGCACAAGACGATGCGGAGAAGGTGGCCGAGTCGCCTGCCAAGCCggtgaagaagccgaagatGACGGAGACAGTGCAa
caggaggaagagaaggacaagcaggtggaggaggagccggAGGACGTCAAgatgcaggacgacgaggaggaagaagaggaggacgcggcgaAGAGCAAGA
CGAAGCGTACGTGGCTGTAGAGGAGAGAGAGTGAAGGTCAGTTTGGCTGATGTGGTTTGCTGTTGTCTTgtttttgctgcagctggtcgccgtcgtctgc
gtcaacgcgtcgtggacgaggacgacgaagacagcgacgaagatCTGCCCATGAGCacgacggacaagaagaaggaggaggtgatcgacatgacgacgct
gatgTCGACTCCGGAGAAGGTCAAGagccccaagaagaaagcggGAAAAAAGCCCGTGATGCcggtgaaggcggcgaaaaagagcaagaaggaggcgaaa
AAGACGCCGGCTGGTCCCAAAAtcgagaaggaagaggccgacgcggacgaggaagaggagattgaagagctcgaagagcttgaagatgccaagctgaaga
aggaggccaaaacgcccgagatgaagaaggaaCATGCGTCTCCTGCTGCATCGAAGACGAGTTTCTTCACTCCGGTATCGAATAAGAAGAATAAAGCCAA
GACGACAACCCCAGCTGATGACAAGAAGGATGCAATGCCCAAGAGTAATTCAGAGGACTCGAAAGAAACacaggaagaggaaggcgacgagcCTCGGGTG
ACCCCGTACTTCGATCTGGCGCACTTGTTCGCCAAAATTGAAGAGGTCACTGGTCGTCTCGTTATCCAAGATCTTCTGACGGCGTTTTTCCGCGACGTCA
TTCGCCGGTCACCTGACGATCTGCTGGCGTGCATCTACCTCTGCGTGTGTGTTGACCTGGCGCCGCCTTTTGAGAACCTGAAGATCGGCATTGGTGATGC
TATTCTGATGAAAGCCATCGGCGAGGCTACGGGCGCAAACCTCAAGTTCATCAAGGAGATGTACCACAAGGAGGGCGATCTCGGTAAGGTTGCGCAGAAC
GCGCGATCAaagcagaagacgctgtcgttTGCGTCGCTCAAACCTGCGACTTCTAAGGGTAGCGGACTCACCGTGCAGCATGTGTACAGCCAATTCGTCA
AGATTGCCAAGATGACCGGAAAcaactcgcagcagcaaaagtgCTCCATCATCAAGGGCTTGCTGGTGAAGTGCGAGAAGGAAAAGAAAGACAAGGGCGC
ACAGTCAGCCGAGGGAGCAAAGTACATCATTCGTGGACTCCAGGGTAAGCTTCGAATTGGACTGGCAGAAAAGTCGATCCTCATGGGATTGACGTACGCG
TTCATGACCGACAAGGAGtacaaggacaaggacaaACAACAAGAGGCTCTTGCCTTTGTCAAGAAGGCCTTTGCCGAGTGCCCCAGCTACAACGCATTGG
TCGCAGCCTTTTTTGAAGTCCAGAAGGAATCCCCTAGTGCTCCCTTCCTTCGCGTGAAGGACTTTGTTAAGGTGGCTGAGAAGTGTGTGCTGACACCAGG
CACACCAGTGTCTCCTATGCTCGCGCGTCCGACCAAGGCGTATGCAATGGTGTTCGATCGCTTCGAAGGCAAGCCGTTCACATGCGAGTACAAGTATGAC
GGTGAACGTGCACAGATCCACATCCTTCCGAATGGAGAAATTGCCATTTTCTCGCGCAACTTCGAAAACTCTACCGAACGATTCCCTGACGTCAAGCTGG
CAATCTCGAACGCGGCTAGGGAGGGCGTCGTCAAGAGCTGCATCGTTGATGCTGAGGTGGTTGCCGTAGATCATGTCACAAACAAGCGTCTGCCATTCCA
GATTCTGAGCACACGCTCTCGAAAGGTACCCCACTAGGTTTCTGGTATTTGCTTGTCTTCGCTGGTGTTTAGCTCGTCTAACTTTGCTCATGTGTCGTTA
TTACAGAACGTGAAGGTGGAGGACATCAAGGTTCATGTATGTATCTACGCGTTCGACTTGCTGTTCCTGAACGGTGATTCCTTCCTCGGCACTCCGCTCG
CGAAGCGCCGTGAAAAGCTGCGCGAGATGTTCGAAGTGAAGCCCGGCAACTTCGAATTCGCTACATCATTAGACGTCGAGGATGGCGTTGATGTGAAAGA
TAACGCTGAGGCGATGGAAGAAGCTGTGGACAAGGTGCGCACATTCCTGGAGGAGGCTGTGCGTGAAAACTGCGAAGGTTTGATGGTGAAGAccctggag
aaggaggcgacgTATGAGCCGGCCAACCGATCACACAAGTGgttgaagctcaagaaggatTACCTAGATGGCATTGGTGATTCTGCCGACCTTGTTCCTA
TCGGTGCGTTCTATGGTCGCGGCAAGCGTACCGGTGTCTACGGTGCCTATTTGCTGGCATGTTACGACCCGGATACGGAGATGTACCAACCGATTACGAA
GCTGGGTACCGGTCTGTCCGATGAAGTGCTCAAGCAATTCTACGATCAactgaaggagaaggtggtcGACAAGCCGCCTAGCGATTATGCCATTGGTGAA
GGAATCAAGCCTGATGTTTGGTTCGAAGCGAGCTGTGTGTGGGAGATTCTAGGTGCAGACCTGTCGATTTCGCCAAAGTACACAGCTGCCATGGGTCTTG
TGGCTAATGACAAGGGCATTTCGTTGCGCTTCCCTCGCTTCATTCGCATCCGTGATGACAAGGAGACGACGCAAGCGACCAGCTCTTCGCAGGTACCTTG
GGTCTCGTATTGGCAAAACTTGATAGATTATGGTTCACTAATGTTTGGTTACTTCTTGTTGAATTCAGATTGCCGATCTGTACCAAGCCCAAGGTCTCAC
AACTCTAACcaacggcgaggaggaggaggacggcgacatGCTTATCTAGGTACAAATGGAATTAATTGCGCTTACCATTGGCACTGGTAAATCTGAAGCC
CACTCATCAAATCTTGCCCCAGATGTACTTCCCTCGTTGCTATTGCTTGGCCAGTtggtttttttttatcaGATTTTCCAGCGAAACGCATCCAAGAAAC
GTCCCAGGCCGCGGAAGTTCATATGTGAGCGCAGCATTTGGCAAGTGTCGCCTTATTTTAAGGGTATGGCTGATCGAACATTCCCGTGGGGCGGAGGAAG
CTCCCCGATGCGGCGAGCCACGGAGCTCagtggacgccgacgccatgACCAACAGCGTCTTCTagtggagctggagctggatgACTCGCTGTACCAAGGC
GCGATACGAGCGGGTATGGAACACAACGCATTGTACCCGGATGGTAGGAGATCGAGCTACGGTGGGGACGCAAGCCACAGCCGACAAGTACTCCCGAGCT
ATGACCAACACTTCATTGCTGAACCAAAGCCGCGTTTGCAGTCTAGAACTTCTCGAGATACAGCGGGCAAGCCACTCACCGAGCgtcagatgcagcagct
ccatgccAAACGTCTCTCAAGTCCATACAAGCTGAAACAGCAAGTGTTAGGCACTCGAAACGACCCGACACCTCAGCACCATCACCAGCAATCATCACAC
AACGCCAGTGGAAGCTCGACACAGCGTGTTTCACGTGCATCATCACTGCAGCAGTCTCCAGCACAACTTGTGATCGAGTCTGTCCGACAAAATATACACT
TGCGCGACCAAGTGATGGCTCACTTACAGCAGGAACTGATGGGGGTGCTGCCGTTGCATCGGGCATCTCATGTGGAGAAGAATGTGCCACAACGAGtagt
gaagctgctgaacagGATGCGTAGTCTGTCGCTTGCAGTGGTGGAAGCAGTGGTGTACTTGTGCACCGAGCTTGGCGACTCGAATCTGGCTGGCACTAGT
GTCGAGCACAATATTCTAGAGCAGGACTTCTACGGATACTTGCTGCAAATGGCGTCTTCCGACACGGACTTTCTTGCGTGCTCGCCATCTCTCCAGCGAT
TCTTTGAAGACTTCGAGGTGAACTTGACGCGTAACCCCTTCTTGGATGGGTTATCCTTGGACTCGTCGGAAGTTCTGCTGTGTTCCTGTCACCAAAGTGC
TTCATCGAGAACATTATTTTGCTctgcctcgtcgtcttcgatATCACTCCTACGATTGTTGACCAATAAGCTCGAGACCTTTGCGCTCCAGACTCAACGA
TACCTCCCGGGGTGGCAAATTTTGCCGGCAGAGCGTGTAGCAGCGGCGTTTCTGCATCTGATGGATCTTGAGACTCGTTTCAATGCTGTTCAAATGATTC
CGAGGTACCTGCAGTCGCACAGCGGTTATAGGAGCCATTTGCATCAACCgattcagcagcaacatgaaCCGGACGAGACTCCGTATGGCTATGGCACCTT
TGAGGACGAAAGGATACAGCGGTTGGATCGACAGGGCTCGCAAGTATCTCGTACAGCTGACATTGATCCACCTTGGAGTGAAATACCTGTGATGCAAGCG
TGGGCTGGTTCACCAACAGTGAAAACTCCAATACCAACCGACGTTAGATCGAGGGTTTTGGGGCCTATAACGGCTGATAAACCACTGGAGTCTCAAACTT
CTGACGACTCGACTCGAAGGTTGTCGAACAAGGAGGACATAGCAAGATCATCATCCGAAGCTAGACTACCATCATCGAGGTCTGCGACTCCTTCTGAACC
ACAGCCGTCCAAGACTTCAAATGACTCGGGTCGAAGATTATCAAGCAACGAAGAGGATGTCAAGCCACCACCCGAACCTAGACCGACGTCTACAAGAGGT
TTAACACCGACACTTCCCGATCAACCTTTGCAAGTTAAATCCGCCAGAAACGTTTCAAGTAAAGAGGAAGACAACCGAAAACCATCGTTGTCATCGTCTG
CATGGATGCAGTTGCCAAGTCCAACAGACCCGACATCCGTGACAAAAAGCTCGTCGCCGGCTAGTTCTAGTCGTTCTCCGCTAGCTTCTGCCACATCGTC
AAGGAAAATGTCAGTTGAGGCTGACTCTGCTGGAATCGCAGACGGTGTCAATGTGGAACTTACGCAGCTGGTGCTACCACCTTCCGTCCTTGACACGACA
GCAGTACCAAAATCATCCAGCAGAAGTATCTCATCTCAAAGGTCTGCGTCCCAAAAGAAAAGCAGAACCACCAAGGAGAAGTGCAGCACATTGGTCGATG
TTGGAATCCAAATGACTCAACGAAATACACCGGCAGCCAATGCAACGCAAAGGTCGGTAAGAAATATTTCAGCGCGACCAATGCACGACGAAGGGATCCA
AGTTTGTGGTGAAACGTTTACCGGTGATGAGTGTGGGAGAAGGCCATCCGTCCCTGTCGTGGCAAACCCGGGGATGGATGCTTCGGAATCTCTGGAATTG
TTTGAACATGTTGAATCTGCACGATCGGATGATCTTCTGGTTCTGAATGCCACAGAACCTGAAGCTTTTGCTTTCTCACCCCTGGTGAAGCCTTTAATGT
TACATCGCTATCCATTTGGGGGAGAACCGAGTGGTTTGATCAGTGGTATGGGGACTCCAACCACGGAAAGGCAGGCCGCATTCTCTGTTGATACAGATGC
CGATGGCGAGGATGAAATAGGTAATGATGTTGGATATGAATGCGACTTTGAGTACTCATCCAACGAGGCGTTATCCAGTATCGCGATGGCGTTGCAAATG
TTGCCAAATTTCTCGCTTTCGACCACGGGATCTACTCTAGCAGGTCAAGTCTTGAATCCAGAAGAAGCAATACCGCCCATCATAGACTCAAGTAGAACGG
AAGAGGACGAGACCAGTCTTACTGATAGCGCTATTGCGAGTGCTACACCGTCTCCTGCCAATTTGTCTCCACCATCAACTCGTAGATCCACACTTTTCGA
GGTTGGTATCTTGTTGGAAAATGTTCCAAGTGAATTGGAAAGCGTCGAACAAAGAGCGGAGATGCCTCCaccagaagacgacgaaTTTGCCTACTCATCG
AGTACAGTTAGATCGAATATTGCTATGGCACTCAGTCTACTGCCGAGCGTCGCGAGAGATAACATATTCTCAGTCCTTGAGGAGGAAGTTGGACATGAGC
CCGAAGTTCAGATGGATGTGAATTCTCCTAGAATCATTACCTACCGATCAATCGTATCTCAACGGGAACAACCGTTGCAAACGTCGAGCGTTGATGAAGC
TCCGATTGAGGAGACTATGGATCAATATTCTCTTTCGTCAGCTCGTAGCTATAACCCAGTGGAGACAAGCAGCCAGCCGATATTCTCTTTGTCTGCGTCA
TCGCGTAGCTATGGCCCCTCACTGACCAGTGAGAGAATAGTGAACTCATCCCCAGTTTCATCTCGTAGCAGCACATCGGCAAGTGACCACGGGGTCCATT
CTCCACCTGTTTCGTTCCGTAGCCAAATTCCAGCAGTGATCAACAACGAAGTGGAGTATTCCGTACCTGCTTCATCCCGTAGCAACATTTCAGGAGCTAC
AAGTTACCAAGGTGACGATGAAAGTGAACCTTCCGAGTTTAACAGGATTTTCGCGCTCTGTCGTGATATCCAAGTTGCAGCATTCGACATGAGCCACTGG
GTATCCCAGCGAGAGGTCGAGGACCATATCCAGACATTTGCTCAgccgttctcgtcgctgatGGGCTACTCGTCCCCTGCGGCTGCAAATGCCAAGGCGG
AGAATGCTCCCAAATACCTGGAGCGCGAgttgaagatgctgcgtcGGAACTTTGCATCTTGGAAGAGTTGGGTCGTAGATCATAAACGAGCACAGCTGAT
CGTGCGCAGACTGGTCGCGAGGAGGAAGGTCCGACAATTTGTTCTTTACCACCAACGGCGACGTGTACAAGCGAGGGTTGACGAAGAAAGCCGTCGTCGA
TTTCTCGCAGCATCGCGAATACAACGACACTGGAGGATTTACTGCCATAACAGAGGAGTTGCCGAGCGCAAGGGTACATTTCGCGTACTTCACATGGCAT
TCCATCGTGCGCTTTTCTTCGTGGGGATTTCAAGACGGCGGGGTAGCCGCGAGCATGCAAAGGAGAAAGTGGTGCGGTGGTGGAGGTACCAGCGCTTCCG
TatcaagaagcagaaacagcGTCAGGAAAAGATtgatcgaggacgagaacaaCGTGCGAGGGCTCTGGGGGACATACAAAAGTTCCTGAAGGAAATTCTA
CTGCGCCGCAAGTTGAAAGCAGCCCaggagatgacgaagaaCATTTTATTCAAGGAGCAACTCAAGAGGACCAAGGCTAAGCGAGACGTGGAGAAGAGCA
TGAGGCTCAACTCCAAGCATCGAAGAGAGCTGATTGCCGATATGAACGCGAGGTTGGCAGATCTCGACCGCCGGTGGAAGGATTCGGAGGAGGAACGGCA
GCGACTACTGAcgcaccacgagcgcgttgtccaacaacaacagcaaacaGGTGaagtacgacgacgaagactcgCAGCTCTGAAGATCCAAATGTTTTTC
AGAATGTGCCTCCTTCATAAGAAGCTGCAGAGAGTTGAAaccgagaagaagcagtaCGAGACCAAGCTGCAAGACGAACTACGTACGAAGAAAGAGCTAG
ACTTTGAGAACCAACAGCGTATCGGCAAGACCCGCACTCAAGTGCGAGTACTGGAGCGGAAAATCGGTCGAATGGCACAAGAAGCTTTGAAAACTGACTC
TCAACACCGTGAAGTCGTTCAAGCTCATCAAGAGCGCGAAATAGCTTctcaagcgcgtgctgctcgacagaAAATTAAGGCGTTCATTGATGCTCGAACG
CTTTGCAGAAGGTCAGACCGCGAACGGCGAAAGCTCTTGCTGGAGCAAGCACGGCTCCAAGCAGAGAAGtccgagcttgagctcatGTCCATTGAAGatc
agctggagcagcgtcggACAGCACAATCGGTTGCTTCGGACCTTCAGCAGCGTTTATCCGAAATGGAAGCACGATCCGAGGCGCTGCTATCAGCTAAGAA
TCGACTGGCAGCAGAGAAGGATGAGGATGCTCGGCTAGCAGCAGAGTCCCTGGAACACAGCAGAGTCGAAGCCAGCATGCACCAAATTGCTTCCTGGGTG
TCAGGACAGATGCAGCTTTCaaagctcaagaaggaaaAAGCTGCAGTCAGCGCAACTGCAGCTCATGAATTGGAGGAGGAAAAGCAGAAGCAACGCAAAG
CGATCGAAGCGAAGATGCGCGAAGTTACATCGATAAAGACTTCAAGCTTCATGCATCAACGCATTAGCCAACACCGCAACCACAAAACGGTCGAAATAAT
TCGGATACAACAACAGCAGAAAGCTgcgcaggagaaggccgTCGCAGATCGCACTCGAGCTCAGTTGGTGCAGATGATTATCGCTGTCAAACTTTTGACT
GAGCACGAGAGCAACAAAGGCATCATTCAGGGATTTGCTGGTGTGGCGCAGTTCTACAAAACACAAGTGCACAAAGTTGCGAGACTGAAGCATTTGCGCA
GCATGAATTGTGCTCGAAAGATCCAACGATCTTGGCGACAATGGAGTCACCAGCAGAGAATTAAACGTGCACAGGAGCTGGCATATGCTCGACTAGAAGA
AGCAGAACGGCTTCAAGCTTCAGCCCGACGGCTTCAAGTTTGGTGGAGGAAATGGGTTCAagagcagcgaagacgacgagagcaaAAACTCGTATTTGAT
GCTCACTTAGAAGCGATTCGAGTCCGAGCCAACGTTCGCAAAATCCAAGGAGTGTGGCGACGTTGGGTTAAACTCAATAACGAGCGAAGACGTGAGCAGC
AGTTAGTCTCCGAAGGAAATCTGGATGCTATTCGTACTCGAGCAAACGTACGCAAAATTCAGAGAGTGTGGAGGCGATGGGTACAGCACGAGCGAAGGCG
ATTACAACAACTAGCTTTTGATGAGCATCTGCTAGCTATTCGCGTTCGAGCCAACGCAAGGACAATCCAAGGGGCATGGAGCCGATGGGTCCAAGGCGAG
CGAGCACGAAGGCATGTGCAGCAGCTAATGTtcaaggcgcagctggaagttATTCGTATTCGAGCCAACGTGCGTAAGATTCAGGTGGCATGGAGGTGCT
GGGTCAAACGCAATCAAGAGCTGGAAAAGCGAAGGCGTGCGCATCGGATGGTGTTCTCAAGCACTCTCCGTGTACagaggtggtggaggacatggcggaa
gaagcagcgagtGAAGGCTACACGAACCCGAATCATGCACAATGCGTGCGCTCAAGTGATCCAAAAGAAATGGAGAAGGTGGCACCGATGGCAACTTGCT
AAGCGAGAAAGACGGCGGCTACGGATTCAGCGAGAAGCTTGTGCGAGGAGATTGCAAAAACTTTGGAGGCAGTGGTGCGTGTGGAGACGTAGACGAGAAG
AAAGCGCCAAGAGAATACAAGATCGCTGGGAAAAGTGgcacaaggagaagaaggaagcgGCGTGCGTCCGAAATGCTCAGATGATGGCGGCTGTACGAAT
TCAGCGAAGTTGGCGTCAGTGGTGGGAGCGGAAACAGAAGGAAAGACGCGAGATTCGCGCTGTTGAACCGATTCAAAGAGCTTGGAGACGATGGCGCAAG
CGATCACTGGAGAAAGCGGATCGAAAACTACAGGAAAAAGAAGAGCGTGAGGTTGCGTTGAAAATAAAGCAGAATTGGGCAGGGAAGCTGTCCCGACGAA
ACAAGGAGCAGGCTGAGCGTAAACGGTGTCTCGGAGCTCAACGGATTCAAGACAAgtggcgtcgacgtcgtcgtcacgagGAAGCTAAACGAGCCAGAAA
ATGTGCTGTAGAAGAGCAGCGTCTCAGCGCAGTGTTGCTTCAGCGAGCATGGAAGAAGTGGCACTTGGCACAGCTTGAAAATGAAAGGCAGGAGAATGAG
CGCCGGACTGCAGCTGCCTTGGTCATTCAAAACCAGTGGCTGAAGATCGATCAGATAGAGGAGCATCTAGAGCAAGAGGCCGAGCAGAGCTATCGAAAAG
ACGAACGGCTACAACAGGAATACGCCACGGAGGCACTCAAAATCCAGGTATTTTGGCGTAAagagcagaagcagcgagaagagcagcgagagatcgagct
catcaagcagaCTCAGACCGCGAGCTCGTTGACAATCCAAAGGAACTGGGGGATTCGTCAACACCGACGCAAGATGGAGCGACAGCGCATTCAGCACGAC
CAAAACATGGCTGCGCTCAAGATCCAGGCGCTTTGGCTCAAGCGGCATCAtgagcaacaagaagaactCGAACGAGAACGCATTCGACAGGAGCAAGATG
AAAGTTCATTCAAGATCGAACGAAACTGGGGGATGGCACAACAGCGCCGAAAGGTATCCCAGGAGCGGCTTCGACACACGCAAAACATCAATGCCTTGAA
GATACAAAAGCactggaggaggtggtggcaCCTTCGCCTTGAAGAACGGACTCAGATCAGAGAAGCAGAGCCCCGAAACCCACGAAATAGTTTAACAACG
GAAGCAAAGCCTGACCCCGAGCAACTTGAACGTGAACGAGAGCGTCAGCAAAAGCTGGAGATTATCACTCGGCGATGCTATGGCCGGTGCATTGCACGCG
CGGTCAAGAGATACCATCAAGGTCAACGGGAGGCGAGTGCTGCGACGAAAATTGAGGCCATCTGGAAGCGTAAGCTGTACCGGATGCACTACCTGCGAGT
GCTCGACGCAAAACACGACGAGGAAGCTCGCCAATATCGACTCATGATATCGGTGCTCGCGACGAAAGTGCAGGTctgctggcggcgatggcaTGCGGGT
GTACGGCAGGTTAAGCGTGCATTTGTGAAAAGCGATGAGCTTCGTTTGATCGAGGAGGCGAAAGCTCTTGAACGGAAGCTACTTGTGGCTAAACGTGCGC
TAGCTGCTAAGCGAATTCAAAGGGCCCTGGCTTCTCGGAGGAGTTTGATCGCAACGAAGGGTGTTTCGCACAGAGAAGTTGTTCAGAAGGAAGTCGTGGT
TAAGCACAACGAGCTGTATGACATGTTGGATGATATGGAACCTGTAAACCAACGTCAGATTGAAGAATGTGCCAGTGAATTTCAAGAACCTGGAAGCGAT
AGCCATGAACTGATAGACACACCAGAGGAAGATTTGGTTCGTGCTACCGTGGAGATGACTGTCGAAGACTGGGGTCACCGACAACTGCCGCATATTCTGT
CGCGCAGTGTGAACCAGGTTTTGTTTTGTCATGAAGCAGCAAGTGTGCTCCAAAAGTGTGTTCGCAATTATTTAAGACGTCAGAAGATGCATTTCAACTT
CCAACGTTCCTTCGCTGCCACGGGCAAAGCGCTGAACGCTGAACGTTTCCACTTCTACTTCAAGTGGGCTAGCGCCTGGTTAGATTGGAACGTGTCCAAG
TCGACCAGCTCCGCAGGTGTAGCAGCGGTGACTACCAGCCAGAACGTCTCCATACTGCGTCTTCGCATCGACTCGCAAATGACGCGTAAACTATTGCAAC
TGTTCGAGCCAAGCGAAGAATATTTGGACTCGGAGATTGAGCAAGTCCTGCAAGAGATTGCAGCTGACGGTTTGCCCATACTGCAATCTCCGGTTTCCTT
GGAAGATAATGACAACTCGAGGCCTGAACTCCGCTATCACGACGTCGAGGAAATGGAACTACCTCGTTCTATCAAACTGCTGCGTCACATGGGGCTACAA
CACGCTCAGATTcaccgtcagcagctcgtagagGTTGAGACAAGTTGTGAGGAGCTCTCACCGTCTCCAGTAGCGAAGTCCGTTCCTTCGTCTCCGATTG
GAAGATCTGCACCGTCATCTCCGTCCCATCGAGCGAAGAAGGAAGTGACGATTTTCACTGCAGTAGACAACGCATCGGTGGAGGACGCTACgttccttca
gcagcgaggtgCAGATCTGGGAGCGCTTGACccgaagacgcagcgcaaTGCACTGCACATGCTGTCGTTTTCCACGGAAAGTTATCAATCTCGAGCTGAG
ATGCTCGATTTCTTGCTCCGTTGTGGTGCCAATCTGAATGTAAATGCCGTGGACTGCAACGGGGATACACCGTTGATGTTGTATGCGTCACTTGGTCACC
TTGAATTCATgcagaaggtgctgcagcatggaGCTGACATTCAAGTAACCAACAGTAGAGGGCAGAATGTGCTGCATCGGGCTTGTGAGGAAGACCAAGT
GGAGGTCTGTGGattcctgcagcagttgatGACGAAGGACTCAGTCGCGGAGAACGTTTTACCTGTCGAAGCGATCTCGCTACTCGCACCAGGAGTTCTC
TCACTTCACACACGTGACAGTGCAGGACGATACCCGCTGCATGGCCTTGCTGAAAAGGGTTTTGTTGAGTGTGCGAAGCAGTTGGTGGTTTCTACCGAGG
CGAATTTTGAGTGGAATCGCCTCCTCCAAGCTCAAGGCGATGCAGAAGGTCGATCAGCGCTGCACCTTGCCGTGTTAACGCACGATGCAGCCATGACCGC
TTTTCTGTTGACCCCTGGAGGAGGCTCAGACGTCAACGCTTTTGACGACCTGCGCCGGTCTCCACTGCACTACGCGGTGGAATCGCCCGCTGCACTTCCG
ATCATTTCTCGGTTGGTTCAGCATGGAGCAAACCTGAATGTATCTGATGAAAGAGGCGACACTCCGCTGCATTGGACGGCCTTCTCAGGTCGCGCTGCCG
TGATGCAAAACCTCTTGACGCTTGGAGCGGACCCAACACTTGCCAACAGCGACTGGGAGACCCCCGCCcagatcgctgctgcttATGGTCAACTCGACTG
CATGCGGCTATTGCTTCAATCTCAACGACGATAtggagctgcgtctgcgaCTGAACCTAGAgaccaccagcagcagcaaccagtGCTGAATCGTCCAGCT
AGCGAGAAGACAGCACTGCAGAGgctggaagaagctgtgACTCACCTTCACCAGAAACAAGCTTCAGCGCACGCTCTTGATCAGGTTACCGATCTAGAGG
CTCTCTGCACCGAGGGTACAAACGAAGCGGTAGCAGTAGCTGAGCAAGCACACAGAGGCTACTGGGAGGAACTGCACCAagacgtgcagctcgtggaaga
GAGCGGGCAGTTCTcgtccgaggacgaagcGGATTTGCTGTTCGgtcacgacgacgatgccTCGAGCTTCTAACTCCACGATaactgcagcgacgaaggT
AGCGACGACAGGAACACGGGGGGTCAGGGAACGCTGTACTTATAGTGTTGCCTAGCCAACTAGGATAAACAGCCAAGAGCCGGGCAAGGCACTCGCTCAG
TGCGCTTGCTGGGCCCGGGTGGTTATTCCAAACACAGAAGCAGAACTTGTCGTTTTACTGTTGTTGCACACGTCGAGTCGCACACTGAATGGtgttcttc
agcagcatggccacgGTCATGGGGCCGACTCCGCCTGGCACAGGCGTGATGGCGTGCACGACCTTGACCGCCGCATCGAAATCCACGTCGCCCACTAGAC
GGTAtccgctcttcttcgttgcGTCCTCCACAGCGTTCATACCGACATCGATCACCGTGGCGCCGGGTTTAATCCAGTCTCCCTGCACGAAGCGCGCGCG
TCCGATGGCCGCAATGACGATGTCGGCCTCAAGCACACGCGCCGGGAGGTCTTGGGTACGCGAATGGCACATGGTCACCGTTGCGTTGCGACGCAGACAC
AGCAATGACACGGGCAGACCGACAATCTGGCTGCGCccgagcaccacgacgtgCTTGCCCTCGAGCGGGATCTTGTAgtggtccagcagctccaggcaGC
CGGCGGGCGTGCAGGGCAGCGCGAACGGcgcctcctcgcgctgcgccgaCGCCTTCTTGGTCGCGAACTGGAAGAGGCTCGCGTGGTTCTCGGGGTGCAA
GCcgtccacgtccttcttggggTCGATGGTGGAGAGgatggcgtcttcgtcgcagaacgacggcagcggcagctgcacgaTGATGCCATCGACGTCCATG
CGCTCGTTGAGCTCCTGgatcgtggccagcagctcgcccgtcACCTTCTCCGCGGgcttctcgccgtcgtcctcgtccagtGGGATCTGCATCTTCCAGG
ACGCGATGCCCGCGGCCGTGCAcgccttctgcttcatgCGCACGTACGTGGCCGAGTCCTTGCGAGAgcccacgacgaccacggcCAGACCCACGgggcg
gccgtggcgctgcttgaaggcggcgcactgcggctgaagctgctgcgtgcggATCACGTCACTTGTGgccttgccgtccagcagaaTGGGCGTCTTGGGG
GTCGCCGTCATGCTCTGTGGACTCTCTCGAGTTTGGGTCTTGTCCGCCGTTGCGGCAGATTGCGAAGTGAACGCGACTACCGGATTTGCATTCAACGCGC
GTCTGAGCAGGTCCCCTTGGAAGTAGATTGCATCTGTTTATACAGGTGCATATACTTACACGCGTGGTGATTGGCTGAATCTACGCAGGGGGGGGTAGTC
AGACCAGATCATTATTGACCAgaggaagatgctgctggagctcggaCGCTTCGTGTTCCTGGCGCTGACGGACGCGGCCatgctgccggcgctggacgtg
atgaGGCGCAACCGCCGCCACTTCGAGCTGTTCGTGggcatgctgcagctcgtggtcgccttcagcttcaacgccgccgAGGCCTTCGACACGCAGCTGT
TCCTCAAGGAGGACCAGTGGCACTTTATCTCGGACGTGCTGTCCATCTCgtacttcctgctgctctgcgtGCACCTCATGGGCTACAAGGACGAGAACCA
CAACATTGTGCTGCGCTACGTGGCGTTCGCGGGCGCCTGGCTCTTCAAGACTAAGGACGGCTGGGACTCGACACTCTACGAAGGggtgctcgtcgtctgc
tACCTCGTTGGCGTCGTCTACCGCCGCGGcttcacgcccagcagcaatATTTCCCCACTGAGCAAACAGAATGCGATGTACGCAGTGGGCTGTCTGGCCG
CAGCGGCTATTGTCGGCTTCATCGCTATCTTCTTTGAGGACGACAAGAACCACACGGCGTTGGGGTTCGCCAAGGGCTTGATGCACATGCTGGGCGGCGC
AGCGTTCTACTACGCGTGGCTCTCAGTGCCCTGCATGGATTCCAAGAAGGATGACATCATCCCCACGCACAGCTCGTTCGTGTAGAgtggagcgactgca
gatGCAACTTCATCAGTGGAACTTCATTGCTTCTCCTCTCTTACTcggtttgctgctgctccgacgcGCTGCGGTGAGTGAGGAAGAATTCATAGAGAGT
CTCAATCGGCTTCACATCCGTCTTTTCCGAGATCTGTAGCGTAGGTACCAGATGTAAGTTGAAAAAGAGACTACCATCATGGAAATGTGCACGCTGTTGG
CAGCCGTACCTGTCTTCCGTGGGCACGCTCGAAGTACCTTGTATACAGTGTGAGCAGCACATGCAACGACGTCAGGAACGAGTTGGTGCAGCCGATGGAC
TGCTGCAGACACTGCCGATAGTCGGGATCCCGCTCAAGAAGGAAaagcttgagcagcgcatACGCTTCGTGAAGCATCAAGACTTCTCCATACAGCTTCG
GTGTTTTCTGGCTGTCACCGGCACGCTTCTGAGGCTGCGCATTGAGATAGCGCTTGATAGTGGCTTTCTCGCATCGTAGACGCTCAACAGGCCACTTCGG
GCAATCCACCAGCCACGAGCCGCGACGAGTTTCATCACCAttgttgtcctcgtcgtcttgagCGGGCTCCTCggtgcgctcgctgtcaGCACTAATTAGG
AGATGAAGTAGCGAGTCTTTGCGAG