Description :
From Genome Similarity Track
Location :
contig_75:82063- 83257
Transcript NameFunction/comments
g10002.t1hypothetical protein

Sequence
1194 bases(100 bases per row)
CATTCTTGCAGACTGAGTAATGGCGAAGTGCAGAGCTGATGAATGGCTAGCTCGCTGCGTAACCTATCGACTGGTGGTAATTATCTCCGGGGTGCCTTTT
GATATGTCATGATAGATGATCAAAATGGAGTAATCTGATAGGTTGATATTTTTTCAACCGTCGCCTGCAAGGGGTGCCTTTTGATAAGAGTTTTGCGGTA
TTGGTGCGATCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAGGTGTGATTCCTGCATCTAGGATGGCAGGTAGTCCGTCT
TCATCACGTTGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCTTACCGTCTGCCGACTTGGATGTCAGTAGCCACT
TAAGCACAGAGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTCTAGGACTCGCATGATTGAAATCACTTCCTTCTC
GGCGAGCTGGTATCTCAGCTCAGCGTCGTTCAGGACACGCCCCGTGAAGCGAACCGGATGAATGACTCCATCGTACTCTTGGCCTAGTACCGCAGACGCT
ACCCACTGATTAGCATGCGGGATGATCACAAATGGTCGTGTGCGGTCAGGATGCCGCAGTAGTGGAGTCGATACAATCTTGCGCTTCAGGATCTCAAACG
CTTCCTTGGCTCGCGACAAGTCTCGTCCAGCACGTATCTGTTCGTCCGTCAGCTCATATAGGACAGCGGCGATCACGGGGAGGTCTTCGATAAACTTATT
ATAGTAATTCAGACTTCCCATGAAAGACTGCACTCCCTTGAGTGTCTTCGGGAACGGCAAATCCTGGACTCCCTTCGCAATCTTTGGCTTCGCCCGGATA
CCTTCAGCACTAATTCATGCGAGAGTACGGAATGGACAACTTGCCAATCGCTCTTGGGTAGACTTTACAGAGATATTCCAATAGCGTAACCGAAACAGTA
AAGCGTTCAAGTCTTCACACAGGTGATCCCATGTTGGTGCACCATGAGCGATGTCGTCAATGTACGAGCTGCGCCCGAGCACAGGGCCCATCTGAGGTGG
GGCTGGGATGTTACGCTGGAAGACTGTCATCTTATCCGCCAAGATCGAGAAATCCCTCCTCAATACTATCAGGACTCCTGGTTCCAGAGGATCA